or
or
Exact

Results for "ZMAT4"

Variant Events: 91

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ZMAT4     4-0098-003chr8:
40679867-40679868
CACintronicDe novo--Trost2022 G
ZMAT4     3-0742-000chr8:
40734032-40734032
GAintronicDe novo--Trost2022 G
ZMAT4     2-0018-004chr8:
40678541-40678541
CGintronicDe novo--Trost2022 G
ZMAT4     1-0375-003chr8:
40548179-40548179
GAintronicDe novo--Yuen2016 G
ZMAT4     2-0018-004chr8:
40678546-40678547
GTTGintronicDe novo--Trost2022 G
ZMAT4     AU2756306chr8:
40653437-40653437
TGintronicDe novo--Trost2022 G
Yuen2017 G
ZMAT4     MSSNG00359-004chr8:
40678295-40678295
TCintronicDe novo--Trost2022 G
ZMAT4     AU050704chr8:
40578255-40578255
GAintronicDe novo--Trost2022 G
Yuen2017 G
ZMAT4     2-0018-004chr8:
40678532-40678532
TGintronicDe novo--Trost2022 G
ZMAT4     1-0520-003chr8:
40750728-40750728
TCintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
ZMAT4     2-1105-003chr8:
40986733-40986733
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
ZMAT4     AU3984301chr8:
40678295-40678295
TCintronicDe novo--Trost2022 G
ZMAT4     AU060403chr8:
41102025-41102025
GAintergenicDe novo--Yuen2017 G
ZMAT4     AU4150301chr8:
40678295-40678295
TCintronicDe novo--Trost2022 G
ZMAT4     2-1313-003chr8:
41009934-41009934
GAintergenicDe novo--Yuen2017 G
ZMAT4     3-0791-000chr8:
40744377-40744377
TCintronicDe novo--Trost2022 G
ZMAT4     2-1206-003chr8:
41044924-41044924
CTintergenicDe novo--Yuen2017 G
ZMAT4     AU073006chr8:
40468718-40468718
GAintronicDe novo--Trost2022 G
Yuen2017 G
ZMAT4     7-0286-004Achr8:
40755498-40755498
TCupstreamDe novo--Trost2022 G
ZMAT4     1-0006-004chr8:
40980916-40980916
CGintergenicDe novo--Yuen2017 G
ZMAT4     AU028305chr8:
40399579-40399579
GCintronicDe novo--Trost2022 G
Yuen2017 G
ZMAT4     1-0201-004chr8:
40837280-40837280
GAintergenicDe novo--Yuen2017 G
ZMAT4     AU3712302chr8:
40760150-40760150
GAintergenicDe novo--Yuen2017 G
ZMAT4     AU1795302chr8:
41085146-41085146
GCintergenicDe novo--Yuen2017 G
ZMAT4     1-0138-004chr8:
40774680-40774680
AGintergenicDe novo--Yuen2017 G
ZMAT4     2-1290-003chr8:
41009356-41009356
GTintergenicDe novo--Yuen2017 G
ZMAT4     2-1155-003chr8:
40771872-40771872
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
ZMAT4     2-1174-006chr8:
40992041-40992041
CTintergenicDe novo--Yuen2017 G
ZMAT4     AU4235302chr8:
40434041-40434041
GAintronicDe novo--Trost2022 G
Yuen2017 G
ZMAT4     AU4033305chr8:
41102280-41102280
GTintergenicDe novo--Yuen2017 G
ZMAT4     1-0255-003chr8:
40706056-40706056
GAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
ZMAT4     1-0914-003chr8:
40530680-40530680
CTintronicDe novo--Trost2022 G
Yuen2017 G
ZMAT4     AU4150301chr8:
40996218-40996218
GAintergenicDe novo--Yuen2017 G
ZMAT4     2-1626-003chr8:
40676426-40676426
CGintronicDe novo--Trost2022 G
Yuen2017 G
ZMAT4     SP0012812chr8:
40438692-40438692
GAexonicDe novosynonymous SNVNM_001135731
NM_024645
c.C438T
c.C666T
p.H146H
p.H222H
--Fu2022 E
Trost2022 G
Zhou2022 GE
ZMAT4     5-0050-003chr8:
40470480-40470480
CTintronicDe novo--Yuen2017 G
ZMAT4     5-0050-003chr8:
40794692-40794692
ACintergenicDe novo--Yuen2017 G
ZMAT4     AU1223301chr8:
40868329-40868329
GCintergenicDe novo--Yuen2017 G
ZMAT4     AU2123302chr8:
40543523-40543523
GTintronicDe novo--Trost2022 G
Yuen2017 G
ZMAT4     2-0182-003chr8:
40516172-40516172
CCACATintronicDe novo--Yuen2017 G
ZMAT4     7-0035-003chr8:
40766737-40766737
CTintergenicDe novo--Yuen2017 G
ZMAT4     AU038204chr8:
40894660-40894660
CGintergenicDe novo--Yuen2017 G
ZMAT4     A26chr8:
40713407-40713407
GAintronicDe novo--Wu2018 G
ZMAT4     11002.p1chr8:
40731453-40731453
GAintronicDe novo--Turner2016 G
ZMAT4     2-0214-004chr8:
40522350-40522350
GAintronicDe novo--Trost2022 G
Yuen2017 G
ZMAT4     1-0394-003chr8:
40527618-40527618
CTintronicDe novo--Trost2022 G
Yuen2017 G
ZMAT4     AU3729303chr8:
40814774-40814774
TCintergenicDe novo--Yuen2017 G
ZMAT4     1-0556-003chr8:
40485215-40485215
GCintronicDe novo--Trost2022 G
Yuen2017 G
ZMAT4     2-1117-003chr8:
40681225-40681238
CGTGTGTGTGTGTGCGTGTGTGTGTGintronicDe novo--Yuen2017 G
ZMAT4     AU3632301chr8:
40802813-40802813
TAintergenicDe novo--Yuen2017 G
ZMAT4     1-0403-003chr8:
40390322-40390322
CAintronicDe novo--Trost2022 G
Yuen2017 G
ZMAT4     1-0065-005chr8:
40779566-40779566
TTGTTTGTTTTTGTTTTTAintergenicDe novo--Yuen2017 G
ZMAT4     2-1269-003chr8:
41063153-41063153
ACintergenicDe novo--Yuen2017 G
ZMAT4     2-1632-003chr8:
40599715-40599715
CTintronicDe novo--Trost2022 G
Yuen2017 G
ZMAT4     1-0699-003chr8:
40849745-40849745
GTintergenicDe novo--Yuen2017 G
ZMAT4     AU069603chr8:
40433978-40433978
CAintronicDe novo--Yuen2017 G
ZMAT4     MSSNG00254-004chr8:
40474483-40474486
TGAATintronicDe novo--Trost2022 G
ZMAT4     3-0785-000chr8:
40500614-40500614
CGintronicDe novo--Trost2022 G
ZMAT4     2-1730-003chr8:
40878347-40878347
GTintergenicDe novo--Yuen2017 G
ZMAT4     2-1546-003chr8:
40456305-40456305
TCintronicDe novo--Trost2022 G
ZMAT4     2-1295-003chr8:
41062586-41062586
TCintergenicDe novo--Yuen2017 G
ZMAT4     AU3692301chr8:
41026802-41026802
TCintergenicDe novo--Yuen2017 G
ZMAT4     2-1303-003chr8:
40543557-40543557
CTintronicDe novo--Yuen2017 G
ZMAT4     2-1497-003chr8:
40741576-40741576
CAintronicDe novo--Trost2022 G
Yuen2017 G
ZMAT4     SJD_59.3chr8:
40608787-40608787
GAintronicDe novo--Trost2022 G
ZMAT4     AU4056302chr8:
40625214-40625214
GCexonicPaternalstopgainNM_001135731
NM_024645
c.C138G
c.C138G
p.Y46X
p.Y46X
27.28.337E-6Cirnigliaro2023 G
ZMAT4     REACH000189chr8:
40611398-40611398
TCintronicDe novo--Trost2022 G
ZMAT4     AU4056301chr8:
40625214-40625214
GCexonicPaternalstopgainNM_001135731
NM_024645
c.C138G
c.C138G
p.Y46X
p.Y46X
27.28.337E-6Cirnigliaro2023 G
ZMAT4     iHART3272chr8:
40625214-40625214
GCexonicPaternalstopgainNM_001135731
NM_024645
c.C138G
c.C138G
p.Y46X
p.Y46X
27.28.337E-6Ruzzo2019 G
ZMAT4     REACH000319chr8:
40596164-40596164
CTintronicDe novo--Trost2022 G
ZMAT4     iHART3273chr8:
40625214-40625214
GCexonicPaternalstopgainNM_001135731
NM_024645
c.C138G
c.C138G
p.Y46X
p.Y46X
27.28.337E-6Ruzzo2019 G
ZMAT4     MT_195.3chr8:
40608029-40608029
TCintronicDe novo--Trost2022 G
ZMAT4     SP0112775chr8:
40548437-40548437
GAintronicDe novo--Trost2022 G
ZMAT4     2-0090-003chr8:
40903202-40903202
CTintergenicDe novo--Yuen2017 G
ZMAT4     3-0360-000chr8:
40590645-40590646
ATAintronicDe novo--Trost2022 G
ZMAT4     MSSNG00045-003chr8:
40514396-40514396
CTintronicDe novo--Trost2022 G
ZMAT4     2-1215-003chr8:
40873406-40873407
ATAintergenicDe novo--Yuen2017 G
ZMAT4     MSSNG00026-004chr8:
40514739-40514739
TGintronicDe novo--Trost2022 G
ZMAT4     5-5031-003chr8:
40678295-40678295
TCintronicDe novo--Trost2022 G
ZMAT4     2-1343-003chr8:
41018433-41018433
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
ZMAT4     AU3847302chr8:
40514975-40514975
TAintronicDe novo--Trost2022 G
Yuen2017 G
ZMAT4     7-0273-003chr8:
40678295-40678295
TCintronicDe novo--Trost2022 G
ZMAT4     2-0135-004chr8:
40457096-40457096
CGintronicDe novo--Yuen2017 G
ZMAT4     1-0073-003chr8:
40678295-40678295
TCintronicDe novo--Trost2022 G
ZMAT4     5-1012-003chr8:
40678295-40678295
TCintronicDe novo--Trost2022 G
ZMAT4     MSSNG00394-003chr8:
40643468-40643468
CTintronicDe novo--Trost2022 G
ZMAT4     2-1120-003chr8:
40779566-40779566
TTAintergenicDe novo--Yuen2017 G
ZMAT4     MSSNG00121-003chr8:
40674728-40674728
CGintronicDe novo--Trost2022 G
ZMAT4     1-0191-003chr8:
40537546-40537546
CGintronicDe novo--Trost2022 G
Yuen2017 G
ZMAT4     MSSNG00021-003chr8:
40618964-40618964
GAintronicDe novo--Trost2022 G
ZMAT4     MSSNG00347-003chr8:
40628964-40628964
TGintronicDe novo--Trost2022 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More