or
or
Exact

Results for "NTM"

Variant Events: 138

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
NTM     MSSNG00245-003chr11:
131567242-131567242
GCintronicDe novo--Trost2022 G
NTM     2-1163-003chr11:
131283350-131283350
CAintronicDe novo--Yuen2016 G
Yuen2017 G
NTM     2-1529-003chr11:
131753802-131753802
CTintronicDe novo--Trost2022 G
Yuen2017 G
NTM     2-1430-005Achr11:
131599576-131599576
CTintronicDe novo--Trost2022 G
NTM     7-0383-003chr11:
131555115-131555115
CGintronicDe novo--Trost2022 G
NTM     5-5163-003chr11:
131559769-131559769
GAintronicDe novo--Trost2022 G
NTM     MT_35.3chr11:
131535441-131535441
CAintronicDe novo--Trost2022 G
NTM     1-1105-003chr11:
131543826-131543826
CTintronicDe novo--Trost2022 G
NTM     4-0046-003chr11:
131511777-131511777
CTintronicDe novo--Trost2022 G
NTM     MSSNG00039-003chr11:
131527274-131527274
GAintronicDe novo--Trost2022 G
NTM     5-1006-003chr11:
131676905-131676905
GAintronicDe novo--Trost2022 G
NTM     A21chr11:
131947891-131947891
ACintronicDe novo--Wu2018 G
NTM     SJD_66.3chr11:
131690868-131690868
AGintronicDe novo--Trost2022 G
NTM     2-1647-003chr11:
131662400-131662400
CTintronicDe novo--Trost2022 G
NTM     MSSNG00109-004chr11:
131673622-131673622
CTintronicDe novo--Trost2022 G
NTM     3-0183-000chr11:
131613758-131613758
CTintronicDe novo--Trost2022 G
NTM     MSSNG00109-005chr11:
131631945-131631946
ATAintronicDe novo--Trost2022 G
NTM     1-0051-005chr11:
131303042-131303042
CCGCCCGintronicDe novo--Trost2022 G
Yuen2017 G
NTM     14-1011chr11:
131602849-131602849
ATintronicDe novo--Trost2022 G
NTM     AU2310301chr11:
131611730-131611730
ACintronicDe novo--Trost2022 G
NTM     2-0126-004chr11:
131813009-131813009
CCCTintronicDe novo--Trost2022 G
NTM     1-1217-003chr11:
131813799-131813799
TAintronicDe novo--Trost2022 G
NTM     5-5146-005chr11:
131794179-131794179
TCintronicDe novo--Trost2022 G
NTM     AU2571301chr11:
131811449-131811449
GAintronicDe novo--Trost2022 G
NTM     AU2577301chr11:
131765623-131765623
ATintronicDe novo--Trost2022 G
NTM     1-0980-003chr11:
131783123-131783123
GAintronicDe novo--Trost2022 G
NTM     5-0040-003chr11:
132200673-132200673
CAintronicDe novo--Trost2022 G
Yuen2017 G
NTM     2-1090-003chr11:
131745460-131745460
GTintronicDe novo--Trost2022 G
NTM     3-0621-000Achr11:
131762065-131762065
TCintronicDe novo--Trost2022 G
NTM     1-0441-003chr11:
132095336-132095336
ATintronicDe novo--Yuen2016 G
Yuen2017 G
NTM     REACH000214chr11:
131898973-131898973
GTintronicDe novo--Trost2022 G
NTM     1-0541-003chr11:
131352365-131352365
TGintronicDe novo--Trost2022 G
Yuen2017 G
NTM     2-1806-003chr11:
131927192-131927192
GAintronicDe novo--Trost2022 G
NTM     3-0456-000chr11:
131719340-131719353
CGAGAGAGAGAGAGCGAGAGAGAGAGintronicDe novo--Yuen2017 G
NTM     D4S2Z-01chr11:
131885479-131885479
GAintronicDe novo--Trost2022 G
NTM     1-0465-003Achr11:
131898655-131898655
AGintronicDe novo--Trost2022 G
NTM     AU2129301chr11:
131284612-131284612
GAintronicDe novo--Trost2022 G
Yuen2017 G
NTM     SJD_66.3chr11:
131874454-131874454
ACintronicDe novo--Trost2022 G
NTM     3-0180-000chr11:
131875595-131875595
CGintronicDe novo--Trost2022 G
NTM     AU4159302chr11:
131451689-131451689
GAintronicDe novo--Trost2022 G
Yuen2017 G
NTM     7-0383-003chr11:
131831527-131831527
ACintronicDe novo--Trost2022 G
NTM     AU2227301chr11:
131865064-131865064
GAintronicDe novo--Trost2022 G
NTM     1045chr11:
132032253-132032253
GTintronicDe novo--Trost2022 G
NTM     MSSNG00159-003chr11:
132047751-132047751
AGintronicDe novo--Trost2022 G
NTM     3-0405-000chr11:
132023975-132023975
CTintronicDe novo--Trost2022 G
NTM     MSSNG00053-003chr11:
132025017-132025017
GAintronicDe novo--Trost2022 G
NTM     AU3302302chr11:
131939094-131939094
ACintronicDe novo--Trost2022 G
NTM     5-0001-003chr11:
131959306-131959306
TGintronicDe novo--Trost2022 G
NTM     1-0465-003achr11:
131898655-131898655
AGintronicDe novo--Yuen2017 G
NTM     2-1522-003chr11:
131937077-131937077
TCintronicDe novo--Trost2022 G
NTM     J4K7A_01chr11:
131937988-131937988
CTintronicDe novo--Trost2022 G
NTM     5-0101-003chr11:
132159257-132159257
TCintronicDe novo--Trost2022 G
NTM     2-1086-003chr11:
131995612-131995612
GGTintronicDe novo--Yuen2017 G
NTM     MSSNG00428-003chr11:
132137936-132137938
TAGTintronicDe novo--Trost2022 G
NTM     MSSNG00117-003chr11:
132153835-132153835
CTintronicDe novo--Trost2022 G
NTM     MSSNG00043-004Achr11:
132084358-132084358
CTintronicDe novo--Trost2022 G
NTM     MSSNG00256-005chr11:
132100583-132100583
AGintronicDe novo--Trost2022 G
NTM     2-1176-003chr11:
132036797-132036797
ATintronicDe novo--Yuen2017 G
NTM     MT_189.3chr11:
132063208-132063208
CTintronicDe novo--Trost2022 G
NTM     1-0049-004chr11:
131552741-131552753
GCAGCCGCTGTTTGintronicDe novo--Yuen2017 G
NTM     2-1176-003chr11:
131751103-131751103
AGintronicDe novo--Yuen2017 G
NTM     3-0866-000chr11:
132064534-132064534
TAintronicDe novo--Trost2022 G
NTM     SP0178337chr11:
132200011-132200011
CAintronicDe novo--Trost2022 G
NTM     4-0081-003chr11:
132188141-132188141
GAintronicDe novo--Trost2022 G
NTM     4-0047-003chr11:
132191590-132191590
CTintronicDe novo--Trost2022 G
NTM     2-0012-004chr11:
131995600-131995600
TTAAintronicDe novo--Yuen2017 G
NTM     2-1437-003chr11:
132175944-132175944
GGAintronicDe novo--Trost2022 G
NTM     5-0009-003chr11:
132183435-132183435
TAintronicDe novo--Trost2022 G
NTM     5-0025-003chr11:
132184329-132184332
TATATintronicDe novo--Trost2022 G
Yuen2017 G
NTM     AU034904chr11:
131416223-131416223
GAintronicDe novo--Yuen2017 G
NTM     2-1296-003chr11:
131804403-131804403
TAintronicDe novo--Trost2022 G
Yuen2017 G
NTM     5-0050-004chr11:
131943025-131943025
ATintronicDe novo--Trost2022 G
Yuen2017 G
NTM     AU076508chr11:
131730884-131730884
CTintronicDe novo--Trost2022 G
Yuen2017 G
NTM     AU051503chr11:
131254058-131254058
AGintronicDe novo--Trost2022 G
Yuen2017 G
NTM     2-0256-004chr11:
131528450-131528450
CTintronicDe novo--Trost2022 G
Yuen2017 G
NTM     2-1358-003chr11:
131697127-131697127
CTintronicDe novo--Trost2022 G
Yuen2017 G
NTM     1-0495-003chr11:
131705554-131705554
CTintronicDe novo--Trost2022 G
Yuen2017 G
NTM     AU079104chr11:
131983951-131983951
AGintronicDe novo--Trost2022 G
Yuen2017 G
NTM     AU4093304chr11:
132189292-132189292
GAintronicDe novo--Trost2022 G
Yuen2017 G
NTM     AU1860302 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
NTM     2-1365-003chr11:
131720535-131720535
CTintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
NTM     1-0482-003chr11:
131420608-131420608
TCintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
NTM     A23chr11:
131648218-131648218
TGintronicDe novo--Wu2018 G
NTM     AU4197302chr11:
131605956-131605956
GCintronicDe novo--Trost2022 G
Yuen2017 G
NTM     AU3605304chr11:
131969927-131969927
CTintronicDe novo--Trost2022 G
Yuen2017 G
NTM     1-0206-004chr11:
132008644-132008644
ACintronicDe novo--Trost2022 G
Yuen2017 G
NTM     2-1207-003chr11:
131450712-131450712
GTintronicDe novo--Yuen2016 G
Yuen2017 G
NTM     2-0214-003chr11:
131790875-131790876
TATintronicDe novo--Trost2022 G
Yuen2017 G
NTM     AU3175303 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
NTM     AU3951301chr11:
132047970-132047970
TCintronicDe novo--Trost2022 G
Yuen2017 G
NTM     A11chr11:
131513296-131513296
CTintronicDe novo--Wu2018 G
NTM     2-1152-003chr11:
132229500-132229500
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
NTM     AU2410302chr11:
131813876-131813876
TCintronicDe novo--Trost2022 G
Yuen2017 G
NTM     11002.p1chr11:
131605413-131605413
GAintronicDe novo--Turner2016 G
NTM     1-0403-004chr11:
131803466-131803466
CGintronicDe novo--Trost2022 G
Yuen2017 G
NTM     1-0763-004chr11:
132032529-132032529
GTintronicDe novo--Yuen2017 G
NTM     AU4099301chr11:
131854785-131854785
GAintronicDe novo--Trost2022 G
Yuen2017 G
NTM     14621.p1chr11:
131475780-131475780
TGintronicDe novo--Wilfert2021 G
NTM     AU3634301chr11:
131684551-131684551
GAintronicDe novo--Trost2022 G
Yuen2017 G
NTM     3-0080-000chr11:
131784625-131784625
CTintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
NTM     AU038703chr11:
131604885-131604885
CTintronicDe novo--Trost2022 G
Yuen2017 G
NTM     12321.p1chr11:
131373318-131373318
GAintronicDe novo--Werling2018 G
NTM     AU071804chr11:
131959026-131959026
GAintronicDe novo--Trost2022 G
Yuen2017 G
NTM     1-0320-004chr11:
131735696-131735696
AACACACTintronicDe novo--Yuen2017 G
NTM     2-1525-003chr11:
131289560-131289560
TCintronicDe novo--Trost2022 G
Yuen2017 G
NTM     2-1525-003chr11:
132205331-132205331
GAUTR3De novo--Trost2022 G
Yuen2017 G
NTM     AU073005chr11:
132241265-132241265
CTintergenicDe novo--Yuen2017 G
NTM     1-0465-003chr11:
131898655-131898655
AGintronicDe novo--Yuen2017 G
NTM     2-1506-003chr11:
132165037-132165052
AACACACACACACACAAACACACACACACAintronicDe novo--Yuen2017 G
NTM     AU003405chr11:
131550290-131550296
TGTGCGTTGTintronicDe novo--Yuen2017 G
NTM     217-14304-3540chr11:
132177671-132177672
TGGexonicMaternalframeshift deletionNM_001144058
NM_001144059
NM_016522
NM_001048209
c.615delT
c.615delT
c.615delT
c.615delT
p.N205fs
p.N205fs
p.N205fs
p.N205fs
--Stessman2017 T
NTM     2-0142-003chr11:
131437632-131437632
CTintronicDe novo--Trost2022 G
Yuen2017 G
NTM     1-0497-003chr11:
131509775-131509775
GAintronicDe novo--Trost2022 G
Yuen2017 G
NTM     AU3912303chr11:
131298410-131298410
CTintronicDe novo--Trost2022 G
Yuen2017 G
NTM     SP0029600chr11:
132184896-132184896
AGUTR3De novo--Fu2022 E
NTM     2-1359-004chr11:
131735696-131735696
AACACACTintronicDe novo--Yuen2017 G
NTM     P6Q4Z_01chr11:
131262039-131262039
ACintronicDe novo--Trost2022 G
NTM     2-0223-003chr11:
131867210-131867210
CAintronicDe novo--Trost2022 G
Yuen2017 G
NTM     3-0447-000chr11:
131698316-131698316
AGintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
NTM     2-0210-004chr11:
131433603-131433603
ACintronicDe novo--Trost2022 G
Yuen2017 G
NTM     2-1526-003chr11:
131367990-131367992
CCTATGintronicDe novo--Trost2022 G
NTM     2-1773-003chr11:
131373098-131373098
GTintronicDe novo--Trost2022 G
NTM     1-0952-003chr11:
131323685-131323685
CAintronicDe novo--Trost2022 G
NTM     5-5035-003chr11:
131352918-131352918
GAintronicDe novo--Trost2022 G
NTM     1-1025-003chr11:
131316181-131316181
CTintronicDe novo--Trost2022 G
NTM     7-0166-003chr11:
131323532-131323532
GAintronicDe novo--Trost2022 G
NTM     4-0088-003chr11:
131263968-131263968
TCintronicDe novo--Trost2022 G
NTM     1-0018-003chr11:
131280460-131280460
AGintronicDe novo--Trost2022 G
NTM     2-0304-003chr11:
132079641-132079641
CTintronicDe novo--Trost2022 G
Yuen2017 G
NTM     MSSNG00353-003chr11:
131502086-131502086
ACintronicDe novo--Trost2022 G
NTM     2-0304-003chr11:
132075074-132075074
CTintronicDe novo--Trost2022 G
Yuen2017 G
NTM     MSSNG00046-004chr11:
131510279-131510279
GAintronicDe novo--Trost2022 G
NTM     2-1814-003chr11:
131444973-131444973
CTintronicDe novo--Trost2022 G
NTM     5-5180-003chr11:
131465171-131465171
CAintronicDe novo--Trost2022 G
NTM     MSSNG00437-004chr11:
131430057-131430057
CAintronicDe novo--Trost2022 G
NTM     7-0017-003Achr11:
131441092-131441092
AGintronicDe novo--Trost2022 G
NTM     AU2320301chr11:
131397196-131397196
GAintronicDe novo--Trost2022 G
NTM     3-0703-000chr11:
131421364-131421364
TAintronicDe novo--Trost2022 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More