or
or
Exact

Results for "KCNMA1"

Variant Events: 109

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
KCNMA1     Lim2017:5007chr10:
78761230-78761230
GTexonicDe novononsynonymous SNVNM_001161352c.C2201Ap.T734N13.47-Lim2017 E
KCNMA1     5007chr10:
78761230-78761230
GTexonicDe novononsynonymous SNVNM_001161352c.C2201Ap.T734N13.47-Fu2022 E
Trost2022 G
KCNMA1     2-1605-004chr10:
79264978-79264978
CGintronicDe novo--Trost2022 G
Yuen2017 G
KCNMA1     EX11Achr10:
79163646-79163646
CTexonicDe novononsynonymous SNVNM_001014797
NM_001161352
NM_001161353
NM_001271519
NM_002247
c.G514A
c.G514A
c.G514A
c.G514A
c.G514A
p.A172T
p.A172T
p.A172T
p.A172T
p.A172T
35.0-Fu2022 E
KCNMA1     200675470_1082034721chr10:
78943225-78943225
CTexonicDe novosynonymous SNVNM_001271518
NM_001014797
NM_001161352
NM_001161353
NM_001271519
NM_002247
c.G600A
c.G762A
c.G762A
c.G762A
c.G762A
c.G762A
p.T200T
p.T254T
p.T254T
p.T254T
p.T254T
p.T254T
6.9441.662E-5Fu2022 E
KCNMA1     5-0040-003chr10:
78986191-78986191
GAintronicDe novo--Trost2022 G
Yuen2017 G
KCNMA1     AU1995302chr10:
79321477-79321477
TCintronicDe novo--Yuen2017 G
KCNMA1     AU4032305chr10:
79043681-79043681
CTintronicDe novo--Yuen2017 G
KCNMA1     1-0402-004chr10:
79001094-79001094
ACintronicDe novo--Trost2022 G
Yuen2017 G
KCNMA1     2-1411-003chr10:
79064240-79064240
CTintronicDe novo--Trost2022 G
Yuen2017 G
KCNMA1     08C74467chr10:
78669774-78669774
CGexonicDe novononsynonymous SNVNM_001271518
NM_002247
NM_001014797
NM_001161352
NM_001161353
NM_001271519
c.G2773C
c.G2923C
c.G2935C
c.G3097C
c.G3046C
c.G3013C
p.A925P
p.A975P
p.A979P
p.A1033P
p.A1016P
p.A1005P
33.0-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
KCNMA1     AU4145301chr10:
79073625-79073625
AGintronicDe novo--Trost2022 G
Yuen2017 G
KCNMA1     1-0206-003chr10:
79309033-79309033
GAintronicDe novo--Trost2022 G
Yuen2017 G
KCNMA1     2-0142-004chr10:
79280059-79280059
AAGGTCTGintronicDe novo--Yuen2017 G
KCNMA1     7-0135-003chr10:
79273021-79273021
CAintronicDe novo--Trost2022 G
Yuen2017 G
KCNMA1     7-0135-003chr10:
79273838-79273838
GAintronicDe novo--Trost2022 G
Yuen2017 G
KCNMA1     1-0751-003chr10:
79387727-79387727
AGintronicDe novo--Trost2022 G
Yuen2017 G
KCNMA1     AU3680302chr10:
78878331-78878331
TCintronicDe novo--Trost2022 G
Yuen2017 G
KCNMA1     A14chr10:
79246463-79246463
GAintronicDe novo--Wu2018 G
KCNMA1     AU076508chr10:
78987813-78987813
CTintronicDe novo--Yuen2017 G
KCNMA1     20-0517250-22chr10:
78832998-78832998
TGexonicDe novononsynonymous SNVNM_001271518
NM_001014797
NM_001161352
NM_001161353
NM_001271519
NM_002247
c.A1444C
c.A1606C
c.A1606C
c.A1606C
c.A1606C
c.A1606C
p.N482H
p.N536H
p.N536H
p.N536H
p.N536H
p.N536H
20.7-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
KCNMA1     1-0075-003chr10:
79448925-79448925
CTintergenicDe novo--Yuen2017 G
KCNMA1     AU3811305chr10:
79327122-79327122
TCintronicDe novo--Trost2022 G
Yuen2017 G
KCNMA1     1-0433-004chr10:
79298849-79298849
CTintronicDe novo--Trost2022 G
Yuen2017 G
KCNMA1     SP0000267chr10:
78708954-78708954
GCexonicDe novostopgainNM_001271518
NM_002247
NM_001014797
NM_001161352
NM_001161353
NM_001271519
c.C2331G
c.C2481G
c.C2493G
c.C2655G
c.C2604G
c.C2490G
p.Y777X
p.Y827X
p.Y831X
p.Y885X
p.Y868X
p.Y830X
38.0-Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
KCNMA1     SP0053238chr10:
78669812-78669812
TCexonicnonsynonymous SNVNM_001271518
NM_002247
NM_001014797
NM_001161352
NM_001161353
NM_001271519
c.A2735G
c.A2885G
c.A2897G
c.A3059G
c.A3008G
c.A2975G
p.D912G
p.D962G
p.D966G
p.D1020G
p.D1003G
p.D992G
22.2-Antaki2022 GE
Zhou2022 GE
KCNMA1     2-1475-003chr10:
79318987-79318987
GAintronicDe novo--Trost2022 G
Yuen2017 G
KCNMA1     2-1105-003chr10:
79179317-79179317
ATintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
KCNMA1     200675470@1082034721chr10:
78943225-78943225
CTexonicDe novosynonymous SNVNM_001271518
NM_001014797
NM_001161352
NM_001161353
NM_001271519
NM_002247
c.G600A
c.G762A
c.G762A
c.G762A
c.G762A
c.G762A
p.T200T
p.T254T
p.T254T
p.T254T
p.T254T
p.T254T
6.9441.662E-5Satterstrom2020 E
Trost2022 G
Zhou2022 GE
KCNMA1     13008.p1chr10:
78761230-78761230
GTexonicDe novononsynonymous SNVNM_001161352c.C2201Ap.T734N13.47-Ji2016 E
Krumm2015 E
Krupp2017 E
Satterstrom2020 E
Wilfert2021 G
Zhou2022 GE
KCNMA1     09C90312chr10:
78943225-78943225
CTexonicDe novosynonymous SNVNM_001271518
NM_001014797
NM_001161352
NM_001161353
NM_001271519
NM_002247
c.G600A
c.G762A
c.G762A
c.G762A
c.G762A
c.G762A
p.T200T
p.T254T
p.T254T
p.T254T
p.T254T
p.T254T
6.9441.662E-5Neale2012 E
KCNMA1     MSSNG00033-003chr10:
78632058-78632058
CTUTR3De novo--Trost2022 G
KCNMA1     SP0130204chr10:
78637469-78637469
TTAUTR3De novo-0.002Trost2022 G
KCNMA1     SJD_49.3chr10:
78751237-78751237
CAintronicDe novo--Trost2022 G
KCNMA1     AU4485302chr10:
78891225-78891225
GAintronicDe novo--Trost2022 G
Yuen2017 G
KCNMA1     3-0703-000chr10:
78762479-78762479
TCintronicDe novo--Trost2022 G
KCNMA1     2-1192-003chr10:
78749407-78749407
GCintronicDe novo--Trost2022 G
KCNMA1     SJD_63.3chr10:
78642375-78642375
ACintronicDe novo--Trost2022 G
KCNMA1     Mahjani2021:18chr10:
78647253-78647253
GCexonicnonsynonymous SNVNM_001271518
NM_002247
NM_001014797
NM_001161352
NM_001161353
NM_001271519
c.C3158G
c.C3308G
c.C3320G
c.C3482G
c.C3431G
c.C3398G
p.P1053R
p.P1103R
p.P1107R
p.P1161R
p.P1144R
p.P1133R
19.16-Mahjani2021 E
KCNMA1     4-0062-003chr10:
78861885-78861885
GCintronicDe novo--Trost2022 G
KCNMA1     3-0185-000chr10:
79500949-79500949
TGintergenicDe novo--Yuen2017 G
KCNMA1     AU4462302chr10:
78923943-78923943
GAintronicDe novo--Trost2022 G
Yuen2017 G
KCNMA1     10-1127-003Achr10:
78891949-78891949
AGintronicDe novo--Trost2022 G
KCNMA1     1-0051-004chr10:
79334520-79334522
CATCintronicDe novo--Trost2022 G
Yuen2017 G
KCNMA1     2-1097-003chr10:
78789369-78789369
TAintronicDe novo--Trost2022 G
KCNMA1     1-1058-004chr10:
78830266-78830266
CTintronicDe novo--Trost2022 G
KCNMA1     MSSNG00406-003chr10:
78776792-78776792
CTintronicDe novo--Trost2022 G
KCNMA1     1-0980-003chr10:
78787570-78787570
CTintronicDe novo-1.0E-4Trost2022 G
KCNMA1     7-0351-004chr10:
79021005-79021005
CTintronicDe novo--Trost2022 G
KCNMA1     1-0186-004chr10:
79024870-79024873
CACATGCTintronicDe novo--Trost2022 G
KCNMA1     MSSNG00125-003chr10:
78988749-78988749
TCintronicDe novo--Trost2022 G
KCNMA1     5-0100-003chr10:
79010366-79010366
AGintronicDe novo--Trost2022 G
KCNMA1     2-1491-003chr10:
78969841-78969841
TCintronicDe novo--Trost2022 G
KCNMA1     3-0113-000chr10:
78985736-78985736
TCintronicDe novo--Trost2022 G
KCNMA1     MSSNG00003-004chr10:
78920865-78920865
TAintronicDe novo--Trost2022 G
KCNMA1     3-0795-000chr10:
78950135-78950135
CGintronicDe novo--Trost2022 G
KCNMA1     3-0067-000chr10:
79069200-79069200
GAintronicDe novo--Trost2022 G
KCNMA1     7-0174-003chr10:
79103102-79103102
TCintronicDe novo--Trost2022 G
KCNMA1     1-0552-003chr10:
79271196-79271196
TCintronicDe novo--Trost2022 G
Yuen2017 G
KCNMA1     1-0186-004chr10:
79024880-79024880
TGintronicDe novo--Trost2022 G
KCNMA1     1-0344-003chr10:
78773877-78773877
GTintronicDe novo--Yuen2017 G
KCNMA1     AU046506chr10:
79048542-79048542
GAintronicDe novo--Trost2022 G
KCNMA1     MT_6.3chr10:
79214638-79214638
GAintronicDe novo--Trost2022 G
KCNMA1     MT_78.3chr10:
79249440-79249440
TCintronicDe novo--Trost2022 G
KCNMA1     MSSNG00413-003chr10:
79171784-79171785
CGCintronicDe novo--Trost2022 G
KCNMA1     1018chr10:
79187370-79187370
ATintronicDe novo--Trost2022 G
KCNMA1     MSSNG00158-003chr10:
79147239-79147239
TAintronicDe novo--Trost2022 G
KCNMA1     7-0225-003chr10:
79160655-79160655
AGintronicDe novo--Trost2022 G
KCNMA1     2-1265-003chr10:
79394764-79394764
TAintronicDe novo--Yuen2017 G
KCNMA1     7-0373-003chr10:
79146773-79146773
GAintronicDe novo--Trost2022 G
KCNMA1     SJD_54.3chr10:
79279899-79279899
GAintronicDe novo--Trost2022 G
KCNMA1     REACH000341chr10:
79279972-79279972
GCintronicDe novo--Trost2022 G
KCNMA1     2-0202-003chr10:
78973315-78973315
GAintronicDe novo--Trost2022 G
Yuen2017 G
KCNMA1     SJD_54.3chr10:
79279873-79279873
ACintronicDe novo--Trost2022 G
KCNMA1     5-0033-004chr10:
79056674-79056674
GGTintronicDe novo--Yuen2017 G
KCNMA1     2-1430-005Achr10:
79279897-79279897
GAintronicDe novo--Trost2022 G
KCNMA1     AU036203chr10:
78704706-78704706
CTexonicDe novosynonymous SNVNM_001271518
NM_002247
NM_001014797
NM_001161352
NM_001161353
NM_001271519
c.G2403A
c.G2553A
c.G2565A
c.G2727A
c.G2676A
c.G2562A
p.R801R
p.R851R
p.R855R
p.R909R
p.R892R
p.R854R
6.987-Trost2022 G
Yuen2017 G
Zhou2022 GE
KCNMA1     1-0868-003chr10:
79279863-79279863
GAintronicDe novo--Trost2022 G
KCNMA1     AM04ZF-03chr10:
79279873-79279873
ACintronicDe novo--Trost2022 G
KCNMA1     MT_183.3chr10:
78850158-78850158
TCexonicDe novononsynonymous SNVNM_001271518
NM_001014797
NM_001161352
NM_001161353
NM_001271519
NM_002247
c.A1172G
c.A1334G
c.A1334G
c.A1334G
c.A1334G
c.A1334G
p.N391S
p.N445S
p.N445S
p.N445S
p.N445S
p.N445S
12.82-Trost2022 G
Zhou2022 GE
KCNMA1     MSSNG00199-003chr10:
79258876-79258876
GAintronicDe novo--Trost2022 G
KCNMA1     AU2465301chr10:
78669774-78669774
CGexonicnonsynonymous SNVNM_001271518
NM_002247
NM_001014797
NM_001161352
NM_001161353
NM_001271519
c.G2773C
c.G2923C
c.G2935C
c.G3097C
c.G3046C
c.G3013C
p.A925P
p.A975P
p.A979P
p.A1033P
p.A1016P
p.A1005P
33.0-Zhou2022 GE
KCNMA1     1-0403-004chr10:
79272375-79272375
CAintronicDe novo--Trost2022 G
KCNMA1     MSSNG00257-004chr10:
79372751-79372751
GAintronicDe novo--Trost2022 G
KCNMA1     MSSNG00050-003chr10:
79391001-79391001
CTintronicDe novo--Trost2022 G
KCNMA1     2-1431-003chr10:
79280081-79280081
CGintronicDe novo--Trost2022 G
KCNMA1     4-0073-003chr10:
79294681-79294681
CGintronicDe novo--Trost2022 G
KCNMA1     2-1348-003chr10:
79316666-79316666
CTintronicDe novo--Trost2022 G
Yuen2017 G
KCNMA1     AU4072303chr10:
78866545-78866545
GTintronicDe novo--Trost2022 G
Yuen2017 G
KCNMA1     AU3862305chr10:
78898665-78898665
GAintronicDe novo--Trost2022 G
Yuen2017 G
KCNMA1     1-0193-003chr10:
79530120-79530120
CAintergenicDe novo--Yuen2017 G
KCNMA1     BRK-11–01chr10:
78647208-78647208
AAAexonicDe novoframeshift insertionNM_001271518
NM_002247
NM_001014797
NM_001161352
NM_001161353
NM_001271519
c.3203dupT
c.3353dupT
c.3365dupT
c.3527dupT
c.3476dupT
c.3443dupT
p.M1068fs
p.M1118fs
p.M1122fs
p.M1176fs
p.M1159fs
p.M1148fs
--Abdi2023 G
KCNMA1     2-0318-004chr10:
79307301-79307301
CTintronicDe novo--Trost2022 G
Yuen2017 G
KCNMA1     7-0133-003chr10:
79466274-79466274
AGintergenicDe novo--Yuen2017 G
KCNMA1     7-0141-003chr10:
79540724-79540724
GAintergenicDe novo--Yuen2017 G
KCNMA1     1-0487-003chr10:
78859810-78859810
AGintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
KCNMA1     2-0018-004chr10:
78846339-78846339
GAexonicDe novosynonymous SNVNM_001271518
NM_001014797
NM_001161352
NM_001161353
NM_001271519
NM_002247
c.C1185T
c.C1347T
c.C1347T
c.C1347T
c.C1347T
c.C1347T
p.N395N
p.N449N
p.N449N
p.N449N
p.N449N
p.N449N
8.978-Trost2022 G
Yuen2015 G
Yuen2017 G
Zhou2022 GE
KCNMA1     AU4012302chr10:
78863200-78863200
TCintronicDe novo--Trost2022 G
Yuen2017 G
KCNMA1     1-0757-003chr10:
78981966-78981966
GAintronicDe novo--Trost2022 G
Yuen2017 G
KCNMA1     AU3190305chr10:
79309415-79309415
CTintronicDe novo--Trost2022 G
Yuen2017 G
KCNMA1     AU054303chr10:
78783899-78783899
ATintronicDe novo--Trost2022 G
Yuen2017 G
KCNMA1     AU054303chr10:
78786037-78786037
CTintronicDe novo--Yuen2017 G
KCNMA1     AU054303chr10:
78786039-78786039
AGintronicDe novo--Yuen2017 G
KCNMA1     10C105879chr10:
78869948-78869948
ACexonicDe novononsynonymous SNVNM_001271518
NM_001014797
NM_001161352
NM_001161353
NM_001271519
NM_002247
c.T952G
c.T1114G
c.T1114G
c.T1114G
c.T1114G
c.T1114G
p.F318V
p.F372V
p.F372V
p.F372V
p.F372V
p.F372V
23.7-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Neale2012 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
KCNMA1     1-0104-004chr10:
79422328-79422328
CTintergenicDe novo--Yuen2017 G
KCNMA1     1255JS0019chr10:
78943225-78943225
CTexonicDe novosynonymous SNVNM_001271518
NM_001014797
NM_001161352
NM_001161353
NM_001271519
NM_002247
c.G600A
c.G762A
c.G762A
c.G762A
c.G762A
c.G762A
p.T200T
p.T254T
p.T254T
p.T254T
p.T254T
p.T254T
6.9441.662E-5DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
KCNMA1     08C71716chr10:
78669785-78669785
GAexonicDe novononsynonymous SNVNM_001271518
NM_002247
NM_001014797
NM_001161352
NM_001161353
NM_001271519
c.C2762T
c.C2912T
c.C2924T
c.C3086T
c.C3035T
c.C3002T
p.T921M
p.T971M
p.T975M
p.T1029M
p.T1012M
p.T1001M
29.7-Fu2022 E
KCNMA1     SP0048711chr10:
79347612-79347612
TGintronicDe novo--Fu2022 E
Trost2022 G
KCNMA1     SP0005890chr10:
79397344-79397374
TCCGCCGCCGCCGCCGCCGCCGCTGCTGCCGTexonicDe novononframeshift deletionNM_001014797
NM_001161352
NM_001161353
NM_001271518
NM_001271519
NM_001271520
NM_001271521
NM_001271522
NM_002247
c.27_56del
c.27_56del
c.27_56del
c.27_56del
c.27_56del
c.27_56del
c.27_56del
c.27_56del
c.27_56del
p.9_19del
p.9_19del
p.9_19del
p.9_19del
p.9_19del
p.9_19del
p.9_19del
p.9_19del
p.9_19del
--Fu2022 E
Zhou2022 GE
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More