or
or
Exact

Results for "KCTD1"

Variant Events: 28

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
KCTD1     SP0046531 Complex Event; expand row to view variants  De novononsynonymous SNV, nonframeshift substitutionNM_001142730
NM_001142730
c.G535A
c.535_536AA
p.A179T
N/A
22.9-Fu2022 E
Zhou2022 GE
KCTD1     1-0025-004chr18:
24173447-24173447
AGintronicDe novo--Yuen2017 G
KCTD1     1-0252-003chr18:
24134202-24134203
CGAGATGAAAGAintronicDe novo--Trost2022 G
KCTD1     1-0652-004chr18:
24134202-24134203
CGAAAGATAAintronicDe novo--Trost2022 G
KCTD1     SJD_8.4chr18:
24071048-24071048
AGintronicDe novo--Trost2022 G
KCTD1     13515.p1chr18:
24118008-24118008
TCintronicDe novo--Turner2016 G
KCTD1     1-0481-003chr18:
24119594-24119594
GAintronicDe novo--Trost2022 G
KCTD1     J4K7A_01chr18:
24057575-24057575
AGintronicDe novo--Trost2022 G
KCTD1     REACH000605chr18:
24066205-24066205
TCintronicDe novo--Trost2022 G
KCTD1     1-0079-008chr18:
24215399-24215399
GTintronicDe novo--Trost2022 G
Yuen2017 G
KCTD1     SP0067090chr18:
24039580-24039580
ACintronicDe novo--Trost2022 G
KCTD1     2-1223-003chr18:
24049342-24049342
TCintronicDe novo--Trost2022 G
Yuen2017 G
KCTD1     2-1232-003chr18:
24174612-24174614
TCAGCintronicDe novo--Trost2022 G
KCTD1     1-1160-003chr18:
24176422-24176422
TCintronicDe novo--Trost2022 G
KCTD1     2-1152-003chr18:
24060769-24060769
TCintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
KCTD1     7-0497-003chr18:
24167614-24167614
GAintronicDe novo--Trost2022 G
KCTD1     2-1232-003chr18:
24174599-24174609
GGCTAACTTTATintronicDe novo--Trost2022 G
KCTD1     2-1341-003chr18:
24134230-24134230
AATintronicDe novo--Trost2022 G
KCTD1     1-0646-003chr18:
24142521-24142521
CTintronicDe novo--Trost2022 G
KCTD1     2-1460-003 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
KCTD1     1-0652-004chr18:
24134209-24134209
CAAAAintronicDe novo--Trost2022 G
KCTD1     2-1341-003chr18:
24134224-24134224
GGAAAAGATAAAAAGAAAAAAGAAAintronicDe novo--Trost2022 G
KCTD1     MT_195.4chr18:
24214667-24214667
AGintronicDe novo--Trost2022 G
KCTD1     3-0398-000chr18:
24223486-24223486
TCintronicDe novo--Trost2022 G
KCTD1     1018chr18:
24191889-24191889
GAintronicDe novo--Trost2022 G
KCTD1     5-5149-003chr18:
24194397-24194397
CTintronicDe novo--Trost2022 G
KCTD1     7-0012-003chr18:
24179933-24179933
CTintronicDe novo--Trost2022 G
Yuen2017 G
KCTD1     AU034903chr18:
24254882-24254882
GAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More