or
or
Exact

Results for "LOC283177"

Variant Events: 45

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
LOC283177   2-1245-003chr11:
134679926-134679926
ACintergenicDe novo--Yuen2017 G
LOC283177   2-1114-003chr11:
134353520-134353520
CTncRNA_intronicDe novo--Yuen2017 G
LOC283177   AU3874302chr11:
134577052-134577052
CTintergenicDe novo--Yuen2017 G
LOC283177   1-0325-003chr11:
134798060-134798060
TAintergenicDe novo--Yuen2017 G
LOC283177   3D614chr11:
134856266-134856301
CAGTGGAGACCCAGCTTGCAGTCCATCAGAGGCTGGCintergenicDe novo--Satterstrom2020 E
Trost2022 G
Zhou2022 GE
LOC283177   2-1231-003chr11:
134554826-134554826
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
LOC283177   1-0473-003chr11:
134893158-134893158
GAintergenicDe novo--Yuen2017 G
LOC283177   2-1267-003chr11:
134639604-134639604
AGintergenicDe novo--Yuen2017 G
LOC283177   AU4186302chr11:
134775141-134775141
CAintergenicDe novo--Yuen2017 G
LOC283177   1-0985-003chr11:
134474770-134474770
TCintergenicDe novo--Yuen2017 G
LOC283177   2-1358-003chr11:
134364376-134364376
GTncRNA_intronicDe novo--Yuen2017 G
LOC283177   2-1353-003chr11:
134567932-134567932
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
LOC283177   AU3801301chr11:
134484916-134484916
CTintergenicDe novo--Yuen2017 G
LOC283177   2-1283-003chr11:
134582967-134582967
ACintergenicDe novo--Yuen2017 G
LOC283177   AU059903chr11:
134794476-134794476
GAintergenicDe novo--Yuen2017 G
LOC283177   AU2100302chr11:
134936937-134936937
AGintergenicDe novo--Yuen2017 G
LOC283177   13324.p1chr11:
134935666-134935666
GAintergenicDe novo--Turner2016 G
LOC283177   AU4013302chr11:
134535831-134535831
CTintergenicDe novo--Yuen2017 G
LOC283177   2-0307-004chr11:
134407419-134407419
AGintergenicDe novo--Yuen2017 G
LOC283177   2-1131-003chr11:
134450004-134450004
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
LOC283177   1-0405-003chr11:
134893372-134893372
GAintergenicDe novo--Yuen2017 G
LOC283177   2-1336-004chr11:
134541026-134541026
GAintergenicDe novo--Yuen2017 G
LOC283177   1-0820-003chr11:
134753090-134753090
GTintergenicDe novo--Yuen2017 G
LOC283177   2-0704-003chr11:
134351179-134351179
GAncRNA_intronicDe novo--Yuen2016 G
Yuen2017 G
LOC283177   2-0007-003chr11:
134380270-134380270
AGintergenicDe novo--Yuen2017 G
LOC283177   2-1577-003chr11:
134731774-134731774
CAintergenicDe novo--Yuen2017 G
LOC283177   AU2293301chr11:
134573425-134573425
GTintergenicDe novo--Yuen2017 G
LOC283177   AU4306302chr11:
134783766-134783766
GAintergenicDe novo--Yuen2017 G
LOC283177   AU3885305chr11:
134775269-134775269
GTintergenicDe novo--Yuen2017 G
LOC283177   A5chr11:
134701690-134701690
AAACACintergenicDe novo--Wu2018 G
LOC283177   AU0638302chr11:
134451132-134451132
CTintergenicDe novo--Yuen2017 G
LOC283177   7-0135-003chr11:
134844498-134844509
AAAGAAGAAGAAAAAGAAGAAGAAGAAintergenicDe novo--Yuen2017 G
LOC283177   1-0452-003chr11:
134327619-134327622
GTATGTncRNA_intronicDe novo--Yuen2017 G
LOC283177   2-1283-004chr11:
134582967-134582967
ACintergenicDe novo--Yuen2017 G
LOC283177   2-1644-004chr11:
134935831-134935831
GTintergenicDe novo--Yuen2017 G
LOC283177   AU074403chr11:
134337175-134337175
AGncRNA_exonicDe novo--Yuen2017 G
LOC283177   1-0285-003chr11:
134513244-134513244
CTintergenicDe novo--Yuen2017 G
LOC283177   2-1314-003chr11:
134662117-134662117
CTintergenicDe novo--Yuen2016 G
LOC283177   1-0640-003chr11:
134562383-134562383
TCintergenicDe novo--Yuen2017 G
LOC283177   1-0059-003chr11:
134639807-134639809
AGGAintergenicDe novo--Yuen2017 G
LOC283177   AU045010chr11:
134714958-134714958
ACintergenicDe novo--Yuen2017 G
LOC283177   2-1466-003chr11:
134552328-134552328
TTAAAAATCintergenicDe novo--Yuen2016 G
LOC283177   1-0674-003chr11:
134318726-134318726
TCncRNA_intronicDe novo--Yuen2017 G
LOC283177   1-0674-003chr11:
134318724-134318724
CAncRNA_intronicDe novo--Yuen2017 G
LOC283177   1-0674-003chr11:
134318717-134318717
TCncRNA_intronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More