or
or
Exact

Results for "MGAT4C"

Variant Events: 146

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MGAT4C     2-1379-003chr12:
88107660-88107660
TAintergenicDe novo--Yuen2017 G
MGAT4C     14590.p1chr12:
87994215-87994215
CTintergenicDe novo--Turner2016 G
MGAT4C     1-0219-003chr12:
86435480-86435480
CGintronicDe novo--Trost2022 G
Yuen2017 G
MGAT4C     13324.p1chr12:
86812796-86812796
GAintronicDe novo--Turner2016 G
MGAT4C     5-0109-003chr12:
87342579-87342579
ATintergenicDe novo--Yuen2017 G
MGAT4C     5-0077-003chr12:
86679960-86679960
TTTAATAATAintronicDe novo--Yuen2017 G
MGAT4C     AU4242302chr12:
87304462-87304462
AGintergenicDe novo--Yuen2017 G
MGAT4C     7-0068-003chr12:
87368064-87368064
CAintergenicDe novo--Yuen2017 G
MGAT4C     2-1093-009chr12:
86503233-86503233
AGintronicDe novo--Trost2022 G
Yuen2017 G
MGAT4C     AU4314302chr12:
86730074-86730074
TCintronicDe novo--Trost2022 G
Yuen2017 G
MGAT4C     AU3638302chr12:
88045259-88045259
CGintergenicDe novo--Yuen2017 G
MGAT4C     1-0358-003chr12:
87701593-87701593
ACintergenicDe novo--Yuen2017 G
MGAT4C     AU0146301chr12:
87062767-87062768
GCGintronicDe novo--Trost2022 G
Yuen2017 G
MGAT4C     AU047704chr12:
86960520-86960520
TCintronicDe novo--Yuen2017 G
MGAT4C     1-0352-005chr12:
87811904-87811904
TCintergenicDe novo--Yuen2017 G
MGAT4C     AU047704chr12:
88053225-88053225
TCintergenicDe novo--Yuen2017 G
MGAT4C     AU3905302chr12:
88131857-88131857
ATintergenicDe novo--Yuen2017 G
MGAT4C     1-0352-005 Complex Event; expand row to view variants  De novo--Yuen2017 G
Yuen2017 G
MGAT4C     AU2019302chr12:
86661120-86661120
CTintronicDe novo--Trost2022 G
Yuen2017 G
MGAT4C     AU2427302chr12:
86391481-86391481
CGintronicDe novo--Trost2022 G
Yuen2017 G
MGAT4C     AU051503chr12:
86949545-86949545
GCintronicDe novo--Trost2022 G
Yuen2017 G
MGAT4C     1-0181-004chr12:
87252897-87252897
GAintergenicDe novo--Yuen2017 G
MGAT4C     2-1167-003chr12:
87680350-87680350
ACintergenicDe novo--Yuen2016 G
Yuen2017 G
MGAT4C     3-0439-000chr12:
87537928-87537928
AGintergenicDe novo--Yuen2016 G
MGAT4C     2-1645-003chr12:
87556818-87556818
GAintergenicDe novo--Yuen2017 G
MGAT4C     2-1333-003chr12:
87712452-87712452
GAintergenicDe novo--Yuen2017 G
MGAT4C     5-0138-003chr12:
87541703-87541703
CTintergenicDe novo--Yuen2017 G
MGAT4C     2-1117-003chr12:
87625352-87625352
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
MGAT4C     AU3794301chr12:
87632546-87632562
TTCTCTCTCTCTCTCTCTTCTCTCTCTCintergenicDe novo--Yuen2017 G
MGAT4C     REACH000058chr12:
86458374-86458374
CTintronicDe novo--Trost2022 G
MGAT4C     AU3794301chr12:
87701184-87701184
GAintergenicDe novo--Yuen2017 G
MGAT4C     1-0672-003chr12:
86473835-86473835
GAintronicDe novo--Trost2022 G
MGAT4C     2-1358-003chr12:
87727128-87727128
ATintergenicDe novo--Yuen2017 G
MGAT4C     AU057503chr12:
86445243-86445243
CTintronicDe novo--Trost2022 G
MGAT4C     7-0105-003chr12:
86454459-86454459
GAintronicDe novo--Trost2022 G
MGAT4C     1-1221-003chr12:
86408541-86408541
GGAintronicDe novo--Trost2022 G
MGAT4C     1-0352-003chr12:
87811904-87811904
TCintergenicDe novo--Yuen2016 G
MGAT4C     REACH000409chr12:
86434635-86434635
CTintronicDe novo--Trost2022 G
MGAT4C     2-1461-003chr12:
86996263-86996263
TAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
MGAT4C     2-1423-003chr12:
86376486-86376486
CTintronicDe novo--Trost2022 G
MGAT4C     2-0116-004chr12:
87150248-87150248
TAintronicDe novo--Trost2022 G
Yuen2017 G
MGAT4C     5-0095-003chr12:
87080965-87080965
TCintronicDe novo--Yuen2017 G
MGAT4C     1-0649-003chr12:
86595368-86595368
CAintronicDe novo--Trost2022 G
MGAT4C     1-0670-003chr12:
86606459-86606459
GAintronicDe novo--Trost2022 G
MGAT4C     MSSNG00056-003chr12:
86542666-86542666
CTintronicDe novo--Trost2022 G
MGAT4C     MSSNG00165-003chr12:
86544903-86544906
ATTCAintronicDe novo--Trost2022 G
MGAT4C     1-0777-003chr12:
87680281-87680281
TCintergenicDe novo--Yuen2017 G
MGAT4C     AU055603chr12:
86514019-86514019
ACintronicDe novo--Trost2022 G
MGAT4C     MSSNG00035-003chr12:
86516451-86516451
TAintronicDe novo--Trost2022 G
MGAT4C     2-1164-003chr12:
87911179-87911179
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
MGAT4C     AU004403chr12:
86484271-86484271
TCintronicDe novo--Trost2022 G
MGAT4C     2-1750-003chr12:
86495888-86495888
GAintronicDe novo--Trost2022 G
MGAT4C     AU2320301chr12:
86682276-86682276
TGintronicDe novo--Trost2022 G
MGAT4C     1-0820-003chr12:
86833828-86833828
GCintronicDe novo--Trost2022 G
Yuen2017 G
MGAT4C     MSSNG00038-004chr12:
86688894-86688894
TCintronicDe novo--Trost2022 G
MGAT4C     7-0082-003chr12:
87073168-87073168
ACintronicDe novo--Trost2022 G
Yuen2017 G
MGAT4C     MSSNG00100-003chr12:
86661536-86661537
ATAintronicDe novo--Trost2022 G
MGAT4C     2-0045-003chr12:
86663207-86663207
AGintronicDe novo--Trost2022 G
MGAT4C     1-0382-003chr12:
86653542-86653543
TCGAintronicDe novo--Trost2022 G
MGAT4C     1-0382-003chr12:
86653547-86653555
CTCAGTAAAACAAATGAGintronicDe novo--Trost2022 G
MGAT4C     AU2310301chr12:
86634285-86634285
TGintronicDe novo--Trost2022 G
MGAT4C     AU055603chr12:
86636719-86636719
CCTintronicDe novo--Trost2022 G
MGAT4C     3-0456-000Bchr12:
86997008-86997018
ATATATTATATATATATintronicDe novo--Yuen2017 G
MGAT4C     1-1191-003chr12:
86810744-86810744
CTintronicDe novo--Trost2022 G
MGAT4C     AU2231301chr12:
86811508-86811508
TCintronicDe novo--Trost2022 G
MGAT4C     AU3807302chr12:
86612399-86612399
TCintronicDe novo--Trost2022 G
Yuen2017 G
MGAT4C     AU3861303chr12:
87022195-87022195
ATintronicDe novo--Trost2022 G
Yuen2017 G
MGAT4C     AU055603chr12:
86795856-86795856
GTintronicDe novo--Trost2022 G
MGAT4C     7-0441-003chr12:
86800803-86800803
TAintronicDe novo--Trost2022 G
MGAT4C     1-1036-003chr12:
86743379-86743379
TGintronicDe novo--Trost2022 G
MGAT4C     3-0093-000chr12:
86789292-86789292
GAintronicDe novo--Trost2022 G
MGAT4C     MT_15.3chr12:
86736845-86736845
CTintronicDe novo--Trost2022 G
MGAT4C     AU4033304chr12:
87316562-87316562
GAintergenicDe novo--Yuen2017 G
MGAT4C     5-5146-003chr12:
86736879-86736879
TCintronicDe novo--Trost2022 G
MGAT4C     1-0142-005chr12:
87390834-87390834
ACintergenicDe novo--Yuen2017 G
MGAT4C     AUTPGX_1020chr12:
86994933-86994933
GTintronicDe novo--Trost2022 G
MGAT4C     1-0142-005chr12:
86826022-86826022
GGAintronicDe novo--Trost2022 G
Yuen2017 G
MGAT4C     AU2320301chr12:
86996672-86996672
TTGGintronicDe novo--Trost2022 G
MGAT4C     7-0412-003chr12:
86916086-86916086
TCintronicDe novo--Trost2022 G
MGAT4C     3-0111-000chr12:
87166264-87166264
AGintronicDe novo--Yuen2016 G
MGAT4C     3-0221-000chr12:
86969546-86969546
TCintronicDe novo--Trost2022 G
MGAT4C     37338chr12:
86373419-86373419
CTexonicDe novononsynonymous SNVNM_013244c.G1085Ap.S362N16.72-Fu2022 E
Trost2022 G
MGAT4C     SJD_23.3chr12:
86875295-86875295
AGintronicDe novo--Trost2022 G
MGAT4C     2-1169-003chr12:
86906336-86906337
GCTTintronicDe novo--Trost2022 G
MGAT4C     REACH000426chr12:
86828954-86828954
CAUTR5De novo--Trost2022 G
MGAT4C     REACH000182chr12:
86837364-86837364
TGintronicDe novo--Trost2022 G
MGAT4C     AU2310301chr12:
87149350-87149351
CTCintronicDe novo--Trost2022 G
MGAT4C     1-0756-005chr12:
88127481-88127481
TCintergenicDe novo--Yuen2017 G
MGAT4C     2-0278-003chr12:
87496655-87496655
ATintergenicDe novo--Yuen2017 G
MGAT4C     2-1740-003chr12:
87181321-87181321
GAintronicDe novo--Trost2022 G
MGAT4C     AU2729301chr12:
87123605-87123605
TCintronicDe novo--Trost2022 G
MGAT4C     MSSNG00037-003chr12:
87130370-87130370
CTintronicDe novo--Trost2022 G
MGAT4C     2-1155-003chr12:
87226812-87226812
GAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
MGAT4C     AU000704chr12:
86852494-86852494
CTintronicDe novo--Trost2022 G
Yuen2017 G
MGAT4C     MT_191.3chr12:
87093141-87093141
ACintronicDe novo--Trost2022 G
MGAT4C     2-1688-003chr12:
87095780-87095780
AGintronicDe novo--Trost2022 G
MGAT4C     3-0129-000chr12:
87046400-87046400
TCintronicDe novo--Trost2022 G
MGAT4C     SJD_22.3chr12:
87082518-87082518
TCintronicDe novo--Trost2022 G
MGAT4C     MSSNG00033-003chr12:
87230196-87230196
CTintronicDe novo--Trost2022 G
MGAT4C     1-0956-003chr12:
87204780-87204785
TTTTGAATGTATintronicDe novo--Trost2022 G
MGAT4C     2-1644-003chr12:
87466365-87466365
TCintergenicDe novo--Yuen2017 G
MGAT4C     1-0903-004chr12:
87227601-87227601
GTintronicDe novo--Trost2022 G
MGAT4C     2-1433-004chr12:
87204770-87204772
AAATATGintronicDe novo--Trost2022 G
MGAT4C     2-1548-003chr12:
87204770-87204772
AAATATGintronicDe novo--Trost2022 G
MGAT4C     SJD_22.3chr12:
87186376-87186376
TCintronicDe novo--Trost2022 G
MGAT4C     3-0325-000chr12:
87191820-87191820
TAintronicDe novo--Trost2022 G
MGAT4C     2-0242-003chr12:
86749652-86749652
CGintronicDe novo--Trost2022 G
Yuen2017 G
MGAT4C     2-1738-003chr12:
87901383-87901383
CTintergenicDe novo--Yuen2017 G
MGAT4C     AU4235303chr12:
86855906-86855906
TCintronicDe novo--Trost2022 G
Yuen2017 G
MGAT4C     2-1166-003chr12:
87866136-87866136
CTintergenicDe novo--Yuen2016 G
MGAT4C     AU3794302chr12:
87665148-87665148
ACintergenicDe novo--Yuen2017 G
MGAT4C     2-1486-003chr12:
87888327-87888327
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
MGAT4C     5-0148-003chr12:
86494227-86494227
TCintronicDe novo--Trost2022 G
Yuen2017 G
MGAT4C     2-1152-003chr12:
87605725-87605725
GCintergenicDe novo--Yuen2016 G
Yuen2017 G
MGAT4C     1-0625-003chr12:
87924261-87924261
CTintergenicDe novo--Yuen2017 G
MGAT4C     AU4056301chr12:
87280502-87280502
ATintergenicDe novo--Yuen2017 G
MGAT4C     1-0668-003chr12:
87822634-87822634
GCintergenicDe novo--Yuen2017 G
MGAT4C     2-1437-003chr12:
87712137-87712137
GAintergenicDe novo--Yuen2017 G
MGAT4C     7-0256-003chr12:
87510058-87510058
TAintergenicDe novo--Yuen2017 G
MGAT4C     1-0481-003chr12:
88031464-88031464
ATintergenicDe novo--Yuen2017 G
MGAT4C     2-1290-003chr12:
88100761-88100761
TGintergenicDe novo--Yuen2017 G
MGAT4C     AU038703chr12:
87058466-87058466
ATintronicDe novo--Trost2022 G
Yuen2017 G
MGAT4C     AU4129303chr12:
86809370-86809370
AGintronicDe novo--Trost2022 G
Yuen2017 G
MGAT4C     1-0289-004chr12:
86685261-86685262
CTCintronicDe novo--Trost2022 G
Yuen2017 G
MGAT4C     14666.p1chr12:
86373419-86373419
CTexonicDe novononsynonymous SNVNM_013244c.G1085Ap.S362N16.72-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
Zhou2022 GE
MGAT4C     2-1266-003chr12:
88163755-88163755
GAintergenicDe novo--Yuen2017 G
MGAT4C     1-0244-003chr12:
87981578-87981578
TAintergenicDe novo--Yuen2016 G
Yuen2017 G
MGAT4C     1-0173-004chr12:
88162946-88162946
GCintergenicDe novo--Yuen2017 G
MGAT4C     2-1292-004chr12:
87582563-87582583
ACATTACCAAAGAGCAAAATGAintergenicDe novo--Yuen2017 G
MGAT4C     7-0100-003chr12:
87263747-87263747
TGintergenicDe novo--Yuen2017 G
MGAT4C     2-1506-003chr12:
87264729-87264729
AGintergenicDe novo--Yuen2017 G
MGAT4C     AU2975302chr12:
87945637-87945637
GTintergenicDe novo--Yuen2017 G
MGAT4C     AU4228301chr12:
87468916-87468927
ACCTCCTCCTCCACCTCCTCCTCCTCCintergenicDe novo--Yuen2017 G
MGAT4C     1-0257-003chr12:
87524671-87524671
GCintergenicDe novo--Yuen2017 G
MGAT4C     Lim2017:37338chr12:
86373419-86373419
CTexonicDe novononsynonymous SNVNM_013244c.G1085Ap.S362N16.72-Lim2017 E
MGAT4C     1-0656-003chr12:
87368478-87368482
CAAAACAAAAAintergenicDe novo--Yuen2017 G
MGAT4C     AU3724301chr12:
87540963-87540963
GAintergenicDe novo--Yuen2017 G
MGAT4C     1-0257-003chr12:
87524677-87524677
AGintergenicDe novo--Yuen2017 G
MGAT4C     AU3680301chr12:
86491911-86491911
TAintronicDe novo--Yuen2017 G
MGAT4C     1-0067-004chr12:
87833670-87833670
TCintergenicDe novo--Yuen2017 G
MGAT4C     2-1428-003chr12:
87706803-87706803
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
MGAT4C     AU046707chr12:
88140089-88140089
TCintergenicDe novo--Yuen2017 G
MGAT4C     AU4168306chr12:
87940415-87940415
AGintergenicDe novo--Yuen2017 G
MGAT4C     2-1337-003chr12:
87283516-87283516
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
MGAT4C     1-0699-003chr12:
87083863-87083863
GAintronicDe novo--Trost2022 G
Yuen2017 G
MGAT4C     AU050910chr12:
87383938-87383938
GAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More