or
or
Exact

Results for "BRINP1"

Variant Events: 52

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
BRINP1     AU3906301chr9:
122205999-122206003
CCTCTCCTintergenicDe novo--Yuen2017 G
BRINP1     1-0296-003chr9:
121971589-121971589
AGintronicDe novo--Trost2022 G
BRINP1     1-0296-004chr9:
121971603-121971603
GCintronicDe novo--Trost2022 G
BRINP1     1-0985-003chr9:
122061126-122061126
TCintronicDe novo--Trost2022 G
Yuen2017 G
BRINP1     5-5101-003chr9:
121967320-121967320
TCintronicDe novo--Trost2022 G
BRINP1     1-0296-004chr9:
121971589-121971589
AGintronicDe novo--Trost2022 G
BRINP1     AU2328301chr9:
121935142-121935142
GAintronicDe novo--Trost2022 G
BRINP1     REACH000525chr9:
121942108-121942109
CTCintronicDe novo--Trost2022 G
BRINP1     7-0168-003chr9:
122558693-122558693
GCintergenicDe novo--Yuen2017 G
BRINP1     2-0142-004chr9:
121930864-121930870
CTGGATGGTTTACTTAAintronicDe novo--Trost2022 G
BRINP1     AU2718301chr9:
121931879-121931879
GAintronicDe novo--Trost2022 G
BRINP1     2-0018-004chr9:
121985556-121985556
AGintronicDe novo--Trost2022 G
Yuen2017 G
BRINP1     2-1105-003chr9:
122371560-122371560
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
BRINP1     2-1526-004chr9:
121965415-121965415
GAintronicDe novo--Trost2022 G
Yuen2017 G
BRINP1     REACH000026chr9:
122106831-122106831
CTintronicDe novo--Trost2022 G
BRINP1     5-1012-003chr9:
122112327-122112327
TCintronicDe novo--Trost2022 G
BRINP1     1-0045-004chr9:
122422750-122422750
GCintergenicDe novo--Yuen2017 G
BRINP1     MSSNG00101-004chr9:
122088731-122088735
ATAATAintronicDe novo--Trost2022 G
BRINP1     1-0045-004chr9:
122422132-122422132
TAintergenicDe novo--Yuen2017 G
BRINP1     AU051504chr9:
122433902-122433902
CTintergenicDe novo--Yuen2017 G
BRINP1     MSSNG00037-004Achr9:
122091119-122091119
CAintronicDe novo--Trost2022 G
BRINP1     1-0680-003chr9:
122016731-122016731
AGintronicDe novo--Trost2022 G
BRINP1     1-1006-003Achr9:
122064957-122064957
TCintronicDe novo--Trost2022 G
BRINP1     AU003403chr9:
122690774-122690774
TAintergenicDe novo--Yuen2017 G
BRINP1     1-0296-003chr9:
121971603-121971603
GCintronicDe novo--Trost2022 G
BRINP1     2-1644-003chr9:
121979076-121979077
TAATintronicDe novo--Trost2022 G
BRINP1     AU076704chr9:
122145117-122145117
GAintergenicDe novo--Yuen2017 G
BRINP1     1-0651-003chr9:
122675349-122675349
CTintergenicDe novo--Yuen2017 G
BRINP1     AU4379301chr9:
122120772-122120772
GCintronicDe novo--Trost2022 G
Yuen2017 G
BRINP1     1-0763-004chr9:
122075644-122075644
CTUTR5De novo-8.351E-5Trost2022 G
Yuen2017 G
BRINP1     AU1955302chr9:
122550390-122550390
TCintergenicDe novo--Yuen2017 G
BRINP1     3-0432-000chr9:
122375600-122375600
ATintergenicDe novo--Yuen2016 G
Yuen2017 G
BRINP1     AU047704chr9:
121952296-121952296
ATintronicDe novo--Trost2022 G
Yuen2017 G
BRINP1     5-0014-003chr9:
122371529-122371529
GAintergenicDe novo--Yuen2017 G
BRINP1     AU4186302chr9:
122060152-122060152
GCintronicDe novo--Trost2022 G
Yuen2017 G
BRINP1     1-0559-003chr9:
122340134-122340134
GTintergenicDe novo--Yuen2017 G
BRINP1     1-0862-003chr9:
122591505-122591508
GTTCGintergenicDe novo--Yuen2017 G
BRINP1     AU056604chr9:
122433246-122433246
AGintergenicDe novo--Yuen2017 G
BRINP1     1-0073-003chr9:
122062817-122062817
ATintronicDe novo--Trost2022 G
Yuen2017 G
BRINP1     7-0175-003chr9:
122058030-122058030
CTintronicDe novo--Trost2022 G
Yuen2017 G
BRINP1     AU3713301chr9:
122447029-122447029
CTintergenicDe novo--Yuen2017 G
BRINP1     2-1107-003chr9:
122047469-122047469
TCintronicDe novo--Yuen2016 G
BRINP1     AU2123301chr9:
122028190-122028190
AGintronicDe novo--Trost2022 G
Yuen2017 G
BRINP1     2-1178-003chr9:
122656505-122656505
TGintergenicDe novo--Yuen2017 G
BRINP1     AU3586303chr9:
122066652-122066652
TCintronicDe novo--Yuen2017 G
BRINP1     AU3858302chr9:
122308570-122308570
ATintergenicDe novo--Yuen2017 G
BRINP1     2-1261-003chr9:
122203284-122203284
TCintergenicDe novo--Yuen2017 G
BRINP1     2-1730-003chr9:
121932935-121932935
GAintronicDe novo--Yuen2017 G
BRINP1     AU1725306chr9:
122475771-122475771
GAintergenicDe novo--Yuen2017 G
BRINP1     AU1725302chr9:
122666168-122666168
GAintergenicDe novo--Yuen2017 G
BRINP1     2-0142-004chr9:
121930851-121930861
TCAAATACCCCCTTAGGGGTTATintronicDe novo--Trost2022 G
BRINP1     1-0126-004chr9:
122106656-122106656
GAintronicDe novo--Trost2022 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More