or
or
Exact

Results for "LINGO2"

Variant Events: 213

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
LINGO2     1-0191-003chr9:
28217652-28217652
TCintronicDe novo--Trost2022 G
Yuen2017 G
LINGO2     7-0469-003chr9:
28492619-28492619
AGintronicDe novo--Trost2022 G
LINGO2     5-0040-003chr9:
30359106-30359106
TGintergenicDe novo--Yuen2017 G
LINGO2     MSSNG00252-003chr9:
28493638-28493638
ACintronicDe novo--Trost2022 G
LINGO2     1-0111-003chr9:
28412895-28412895
AGintronicDe novo--Trost2022 G
LINGO2     2-1195-003chr9:
28681579-28681579
CTintronicDe novo--Yuen2016 G
Yuen2017 G
LINGO2     AU2328301chr9:
28477084-28477084
AGintronicDe novo--Trost2022 G
LINGO2     2-0028-003chr9:
28066117-28066117
GAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
LINGO2     2-1811-004chr9:
28392396-28392396
TCintronicDe novo--Trost2022 G
LINGO2     7-0127-003chr9:
28397797-28397797
AGintronicDe novo--Trost2022 G
LINGO2     2-1153-003chr9:
29893340-29893340
CGintergenicDe novo--Yuen2016 G
Yuen2017 G
LINGO2     MSSNG00254-003chr9:
28381218-28381222
AAAACAintronicDe novo--Trost2022 G
LINGO2     MSSNG00255-003chr9:
28389046-28389046
AGintronicDe novo--Trost2022 G
LINGO2     AU2216201chr9:
28616156-28616156
CTintronicDe novo--Trost2022 G
LINGO2     1-0677-004Achr9:
28616639-28616639
TAintronicDe novo--Trost2022 G
LINGO2     MSSNG00048-003chr9:
28589146-28589146
TCintronicDe novo--Trost2022 G
LINGO2     10-0010-003chr9:
28592219-28592219
TCintronicDe novo--Trost2022 G
LINGO2     MSSNG00389-003chr9:
28512019-28512019
GAintronicDe novo--Trost2022 G
LINGO2     1-0695-004chr9:
28587346-28587346
AGintronicDe novo--Trost2022 G
LINGO2     MT_179.3chr9:
28498730-28498730
CAintronicDe novo--Trost2022 G
LINGO2     2-1820-003chr9:
28504387-28504387
TCintronicDe novo--Trost2022 G
LINGO2     AU3997302chr9:
30283633-30283633
GCintergenicDe novo--Yuen2017 G
LINGO2     AU055603chr9:
28736879-28736879
TCintronicDe novo--Trost2022 G
LINGO2     7-0094-004chr9:
28744782-28744782
GAintronicDe novo--Trost2022 G
LINGO2     5-0009-003chr9:
28662481-28662481
CAintronicDe novo--Trost2022 G
LINGO2     MSSNG00466-003chr9:
28733315-28733315
ATintronicDe novo--Trost2022 G
LINGO2     MT_19.3chr9:
28654694-28654694
GAintronicDe novo--Trost2022 G
LINGO2     7-0249-004chr9:
29470879-29470879
TAintergenicDe novo--Yuen2017 G
LINGO2     MSSNG00109-005chr9:
28659381-28659381
AGintronicDe novo--Trost2022 G
LINGO2     5-0038-003chr9:
28634338-28634338
GCintronicDe novo--Trost2022 G
LINGO2     MT_38.3chr9:
28644358-28644358
TCintronicDe novo--Trost2022 G
LINGO2     60-2027chr9:
29063462-29063462
GAintronicInherited--Michaelson2012 G
LINGO2     2-1549-003chr9:
28804453-28804453
TAintronicDe novo--Trost2022 G
LINGO2     74-0117chr9:
29256361-29256361
TCintergenicDe novo--Michaelson2012 G
LINGO2     AU2248302chr9:
28494874-28494874
CTintronicDe novo--Yuen2017 G
LINGO2     1026chr9:
28840030-28840030
CAintronicDe novo--Trost2022 G
LINGO2     74-0117chr9:
28359591-28359591
ATintronicDe novo--Michaelson2012 G
LINGO2     1-0736-003chr9:
28763859-28763859
GGAintronicDe novo--Trost2022 G
LINGO2     63-449chr9:
28949138-28949138
CTintronicDe novo--Michaelson2012 G
LINGO2     MSSNG00435-003chr9:
28773722-28773726
GAATCGintronicDe novo--Trost2022 G
LINGO2     5-5025-004chr9:
28755821-28755821
TAintronicDe novo--Trost2022 G
LINGO2     1-0368-004chr9:
30365317-30365317
GTintergenicDe novo--Yuen2017 G
LINGO2     5-5025-004chr9:
28757411-28757411
GTintronicDe novo--Trost2022 G
LINGO2     74-0355chr9:
30288864-30288864
TCintergenicDe novo--Michaelson2012 G
LINGO2     AU2310301chr9:
28748078-28748078
GTintronicDe novo--Trost2022 G
LINGO2     AU2288301chr9:
28753839-28753839
GAintronicDe novo--Trost2022 G
LINGO2     REACH000284chr9:
28881368-28881368
CTintronicDe novo--Trost2022 G
LINGO2     10-0008-003chr9:
28886645-28886645
TCintronicDe novo--Trost2022 G
LINGO2     5-5154-003chr9:
28870031-28870031
ACintronicDe novo--Trost2022 G
LINGO2     MSSNG00349-004chr9:
28873176-28873176
GCintronicDe novo--Trost2022 G
LINGO2     MSSNG00429-003chr9:
28859339-28859339
CAintronicDe novo--Trost2022 G
LINGO2     3-0093-000chr9:
28863112-28863112
AATintronicDe novo--Trost2022 G
LINGO2     MT_155.3chr9:
28842708-28842708
TCintronicDe novo--Trost2022 G
LINGO2     SJD_49.3chr9:
28848833-28848833
TCintronicDe novo--Trost2022 G
LINGO2     1-0672-003chr9:
29074848-29074848
GTintronicDe novo--Trost2022 G
LINGO2     AU3371302chr9:
29076158-29076158
GCintronicDe novo--Trost2022 G
LINGO2     AU4473301chr9:
30166101-30166101
TCintergenicDe novo--Yuen2017 G
LINGO2     4-0047-003chr9:
29055954-29055954
AGintronicDe novo--Trost2022 G
LINGO2     SJD_52.3chr9:
29063075-29063075
ACintronicDe novo--Trost2022 G
LINGO2     2-1179-003chr9:
28963143-28963143
GTintronicDe novo--Trost2022 G
LINGO2     2-0286-004chr9:
29028227-29028227
CCTintronicDe novo--Trost2022 G
LINGO2     5-0009-003chr9:
28930057-28930057
GCintronicDe novo--Trost2022 G
LINGO2     2-1398-003chr9:
28960837-28960838
TCAAintronicDe novo--Trost2022 G
LINGO2     1-1223-003chr9:
29208766-29208766
GCintronicDe novo--Trost2022 G
LINGO2     MSSNG00409-003chr9:
29197187-29197187
ACintronicDe novo--Trost2022 G
LINGO2     1-1036-003chr9:
29201803-29201803
GAintronicDe novo--Trost2022 G
LINGO2     REACH000705chr9:
29085797-29085797
CTintronicDe novo--Trost2022 G
LINGO2     7-0352-003chr9:
29085987-29085987
GCintronicDe novo--Trost2022 G
LINGO2     1-0571-003chr9:
30129805-30129813
CTTTTTTTTCTTTTTTTintergenicDe novo--Yuen2017 G
LINGO2     1-0200-004chr9:
29397792-29397792
CTintergenicDe novo--Yuen2017 G
LINGO2     1-0862-003chr9:
30272664-30272664
AGintergenicDe novo--Yuen2017 G
LINGO2     AU3794301chr9:
28541619-28541619
GAintronicDe novo--Trost2022 G
Yuen2017 G
LINGO2     1-0382-003chr9:
30166062-30166062
GAintergenicDe novo--Yuen2017 G
LINGO2     2-0116-004chr9:
29638100-29638100
AGintergenicDe novo--Yuen2017 G
LINGO2     1-0455-004chr9:
28731447-28731447
TCintronicDe novo--Trost2022 G
Yuen2017 G
LINGO2     AU1640302chr9:
29884558-29884558
TCintergenicDe novo--Yuen2017 G
LINGO2     1-0455-004chr9:
28680740-28680740
AGintronicDe novo--Trost2022 G
Yuen2017 G
LINGO2     1-0338-005chr9:
28100810-28100810
AGintronicDe novo--Trost2022 G
Yuen2017 G
LINGO2     AU4032306chr9:
29903205-29903205
GTintergenicDe novo--Yuen2017 G
LINGO2     2-0007-004chr9:
28127469-28127469
AGintronicDe novo--Trost2022 G
Yuen2017 G
LINGO2     AU4237304chr9:
28829763-28829763
CTintronicDe novo--Trost2022 G
Yuen2017 G
LINGO2     2-1094-004chr9:
29886376-29886376
GAintergenicDe novo--Yuen2017 G
LINGO2     AU4284301chr9:
29545722-29545725
TACATAintergenicDe novo--Yuen2017 G
LINGO2     2-0002-005chr9:
29312542-29312542
ACintergenicDe novo--Yuen2017 G
LINGO2     AU000704chr9:
28289241-28289241
CGintronicDe novo--Trost2022 G
Yuen2017 G
LINGO2     AU3263302chr9:
29026735-29026735
GAintronicDe novo--Trost2022 G
Yuen2017 G
LINGO2     AU0636303chr9:
29779914-29779923
TTTCTGTTCTTTTCTintergenicDe novo--Yuen2017 G
LINGO2     2-1264-003chr9:
30139082-30139097
CTGTGTGTGTGTGTGTCTGTGTGTGTGTGTintergenicDe novo--Yuen2017 G
LINGO2     AU3906301chr9:
28283509-28283509
GCintronicDe novo--Trost2022 G
Yuen2017 G
LINGO2     1-0184-003chr9:
30123305-30123305
GTintergenicDe novo--Yuen2017 G
LINGO2     1-0863-003chr9:
28640063-28640063
CTintronicDe novo--Yuen2017 G
LINGO2     AU2410302chr9:
29801362-29801363
TATintergenicDe novo--Yuen2017 G
LINGO2     2-1213-003chr9:
29548758-29548758
CTintergenicDe novo--Yuen2017 G
LINGO2     2-1510-003chr9:
30357050-30357050
GAintergenicDe novo--Yuen2017 G
LINGO2     AU3506302chr9:
29689993-29689993
CTintergenicDe novo--Yuen2017 G
LINGO2     1-0591-003chr9:
30303858-30303858
TCintergenicDe novo--Yuen2017 G
LINGO2     2-1345-003chr9:
28051878-28051878
GCintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
LINGO2     1-0564-003chr9:
28212987-28212987
TGintronicDe novo--Trost2022 G
Yuen2017 G
LINGO2     2-1244-003chr9:
28945384-28945384
AGintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
LINGO2     2-1451-003chr9:
29175956-29175956
GCintronicDe novo--Trost2022 G
Yuen2017 G
LINGO2     SP0034714chr9:
27949836-27949836
AGexonicDe novosynonymous SNVNM_001258282
NM_152570
c.T834C
c.T834C
p.L278L
p.L278L
--Feliciano2019 E
Fu2022 E
Trost2022 G
Zhou2022 GE
LINGO2     AU4327303chr9:
30368435-30368437
TGATGAAGAintergenicDe novo--Yuen2017 G
LINGO2     1-0010-005chr9:
28231611-28231611
CGintronicDe novo--Trost2022 G
Yuen2017 G
LINGO2     2-1315-003chr9:
28387482-28387482
TCintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
LINGO2     AU073005chr9:
29139788-29139788
GTintronicDe novo--Trost2022 G
Yuen2017 G
LINGO2     A17chr9:
30077919-30077919
AGintergenicDe novo--Wu2018 G
LINGO2     AU4089301chr9:
28126941-28126941
CAintronicDe novo--Trost2022 G
Yuen2017 G
LINGO2     3-0438-000chr9:
28636289-28636291
CATCintronicDe novo--Trost2022 G
Yuen2016 G
LINGO2     2-1375-003chr9:
28989797-28989797
TCintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
LINGO2     AU3889305chr9:
28993158-28993158
AGintronicDe novo--Trost2022 G
Yuen2017 G
LINGO2     1-0565-003chr9:
29202391-29202391
TTTAAintronicDe novo--Yuen2017 G
LINGO2     1-0486-003chr9:
29290331-29290331
CTintergenicDe novo--Yuen2017 G
LINGO2     2-1280-003chr9:
29535581-29535596
AACACACACACACACAAACACACACACACAintergenicDe novo--Yuen2017 G
LINGO2     AU002406chr9:
28672255-28672255
CTintronicDe novo--Trost2022 G
Yuen2017 G
LINGO2     2-0063-005chr9:
28409950-28409950
CGintronicDe novo--Yuen2017 G
LINGO2     AU4211304chr9:
28559769-28559769
CTintronicDe novo--Trost2022 G
Yuen2017 G
LINGO2     AU0146301chr9:
29535496-29535496
ATintergenicDe novo--Yuen2017 G
LINGO2     AU005214chr9:
28429929-28429929
AGintronicDe novo--Trost2022 G
Yuen2017 G
LINGO2     2-0210-005chr9:
29363270-29363270
CGintergenicDe novo--Yuen2017 G
LINGO2     2-1690-003chr9:
29163018-29163018
AGintronicDe novo--Trost2022 G
Yuen2017 G
LINGO2     AU076508chr9:
28799543-28799543
TCintronicDe novo--Trost2022 G
Yuen2017 G
LINGO2     AU1223301chr9:
29395203-29395203
TCintergenicDe novo--Yuen2017 G
LINGO2     1-0162-004chr9:
28171893-28171893
CGintronicDe novo--Yuen2017 G
LINGO2     3-0140-000chr9:
30066231-30066231
TAintergenicDe novo--Yuen2017 G
LINGO2     2-1177-003chr9:
29340608-29340631
TTTTGTTTGTTTGTTTGTTTGTTTTTTTGTTTGTTTGTTTGTTTintergenicDe novo--Yuen2017 G
LINGO2     AU2123301chr9:
28639183-28639183
CTintronicDe novo--Trost2022 G
Yuen2017 G
LINGO2     AU2123301chr9:
28671232-28671232
GAintronicDe novo--Trost2022 G
Yuen2017 G
LINGO2     2-1441-003chr9:
28649156-28649156
CAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
LINGO2     1-0565-004chr9:
29202391-29202391
TTTAAintronicDe novo--Yuen2017 G
LINGO2     2-1454-003chr9:
29754841-29754841
ATintergenicDe novo--Yuen2017 G
LINGO2     1-0701-003chr9:
28133236-28133236
AGintronicDe novo--Trost2022 G
Yuen2017 G
LINGO2     1-0569-003chr9:
29700135-29700135
CAintergenicDe novo--Yuen2017 G
LINGO2     2-1375-003chr9:
28995517-28995517
GCintronicDe novo--Yuen2017 G
LINGO2     2-0503-003chr9:
30224431-30224431
AGintergenicDe novo--Yuen2017 G
LINGO2     1-0560-003chr9:
29020136-29020136
ACintronicDe novo--Trost2022 G
Yuen2017 G
LINGO2     AU071703chr9:
28366049-28366049
ACintronicDe novo--Trost2022 G
Yuen2017 G
LINGO2     1-0051-004chr9:
30188549-30188550
TATintergenicDe novo--Yuen2017 G
LINGO2     2-0135-004chr9:
28764072-28764072
ACintronicDe novo--Yuen2017 G
LINGO2     2-0070-003chr9:
28899580-28899580
GTintronicDe novo--Trost2022 G
Yuen2017 G
LINGO2     AU4467302chr9:
29662066-29662066
GAintergenicDe novo--Yuen2017 G
LINGO2     1-0552-003chr9:
29429316-29429316
GAintergenicDe novo--Yuen2017 G
LINGO2     5-0018-003chr9:
29648658-29648662
TAAACTintergenicDe novo--Yuen2017 G
LINGO2     1-0651-003chr9:
30317562-30317562
CTintergenicDe novo--Yuen2017 G
LINGO2     AU065807chr9:
28075340-28075340
GAintronicDe novo--Trost2022 G
Yuen2017 G
LINGO2     1-0403-004chr9:
29361745-29361745
GAintergenicDe novo--Yuen2017 G
LINGO2     2-0202-003chr9:
29595372-29595372
TCintergenicDe novo--Yuen2017 G
LINGO2     AU2793301chr9:
29037862-29037862
TCintronicDe novo--Trost2022 G
Yuen2017 G
LINGO2     AU025704chr9:
28371535-28371535
CGintronicDe novo--Trost2022 G
Yuen2017 G
LINGO2     AU3779302chr9:
28977276-28977276
CTintronicDe novo--Trost2022 G
Yuen2017 G
LINGO2     1-0467-003chr9:
29467752-29467752
GCintergenicDe novo--Yuen2017 G
LINGO2     2-1173-003chr9:
30196080-30196080
AGintergenicDe novo--Yuen2017 G
LINGO2     1-0524-003chr9:
30092404-30092410
GACAGATGintergenicDe novo--Yuen2016 G
Yuen2017 G
LINGO2     2-1152-003chr9:
28108619-28108619
CTintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
LINGO2     2-0127-004chr9:
28614227-28614227
TAintronicDe novo--Trost2022 G
Yuen2017 G
LINGO2     AU011704chr9:
29256361-29256361
TCintergenicDe novo--Yuen2017 G
LINGO2     AU011704chr9:
28359591-28359591
ATintronicDe novo--Trost2022 G
Yuen2017 G
LINGO2     AU3646301chr9:
29484933-29484942
CTTTAGTTTACTTTAintergenicDe novo--Yuen2017 G
LINGO2     SP0015501chr9:
27949222-27949222
CGexonicDe novononsynonymous SNVNM_001258282
NM_152570
c.G1448C
c.G1448C
p.C483S
p.C483S
13.82-Fu2022 E
Trost2022 G
Zhou2022 GE
LINGO2     1-0180-004chr9:
28235048-28235048
GAintronicDe novo--Trost2022 G
Yuen2017 G
LINGO2     2-0503-004chr9:
30224431-30224431
AGintergenicDe novo--Yuen2017 G
LINGO2     10-1104-003chr9:
28060985-28060985
GCintronicDe novo--Trost2022 G
LINGO2     7-0001-003chr9:
29710563-29710563
GAintergenicDe novo--Yuen2017 G
LINGO2     3-0648-000chr9:
28062605-28062605
ACintronicDe novo--Trost2022 G
LINGO2     7-0357-004chr9:
28039175-28039175
GAintronicDe novo--Trost2022 G
LINGO2     7-0260-003chr9:
28044795-28044795
GAintronicDe novo--Trost2022 G
LINGO2     1-0722-003chr9:
27999471-27999471
TAintronicDe novo--Trost2022 G
LINGO2     REACH000696chr9:
28028907-28028907
GAintronicDe novo--Trost2022 G
LINGO2     AU2688301chr9:
27951908-27951908
GTintronicDe novo--Trost2022 G
LINGO2     3-0380-000chr9:
28156699-28156703
GTTACGintronicDe novo--Trost2022 G
LINGO2     7-0367-003chr9:
28165316-28165316
TCintronicDe novo--Trost2022 G
LINGO2     MSSNG00046-004chr9:
28129899-28129899
TCintronicDe novo--Trost2022 G
LINGO2     4-0043-003chr9:
28138135-28138135
CTintronicDe novo--Trost2022 G
LINGO2     1-0556-003chr9:
28126379-28126379
AGintronicDe novo--Trost2022 G
LINGO2     13171.p1chr9:
28142301-28142301
AGintronicDe novo--Turner2016 G
LINGO2     MSSNG00105-004chr9:
28127178-28127178
GAintronicDe novo--Trost2022 G
LINGO2     1-0973-003chr9:
29933186-29933186
CTintergenicDe novo--Yuen2017 G
LINGO2     1-0565-003chr9:
28073892-28073893
ATCCintronicDe novo--Trost2022 G
LINGO2     1-0354-003chr9:
28560994-28560994
TCintronicDe novo--Trost2022 G
Yuen2017 G
LINGO2     1-0973-003chr9:
29154712-29154712
GCintronicDe novo--Trost2022 G
Yuen2017 G
LINGO2     MT_89.3chr9:
28077952-28077952
AGintronicDe novo--Trost2022 G
LINGO2     14153.p1chr9:
29706081-29706081
TCintergenicDe novo--Turner2016 G
LINGO2     1-0655-003 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
LINGO2     13393.p1chr9:
30259585-30259585
CAintergenicDe novo--Turner2016 G
LINGO2     7-0405-003chr9:
28204959-28204959
TCintronicDe novo--Trost2022 G
LINGO2     13023.p1chr9:
28725582-28725582
GAintronicDe novo--Turner2016 G
LINGO2     MSSNG00095-003chr9:
28193777-28193777
GCintronicDe novo--Trost2022 G
LINGO2     13171.p1chr9:
28821750-28821750
GAintronicDe novo--Turner2016 G
LINGO2     1-0338-003chr9:
28195390-28195393
AAAAGGCCGGintronicDe novo--Trost2022 G
LINGO2     3-0405-000chr9:
28175116-28175116
CAintronicDe novo--Trost2022 G
LINGO2     MT_69.3chr9:
28190079-28190079
CAintronicDe novo--Trost2022 G
LINGO2     2-1066-004chr9:
28171877-28171877
AGintronicDe novo--Trost2022 G
LINGO2     2-1066-004chr9:
28171883-28171883
GAintronicDe novo--Trost2022 G
LINGO2     1-0845-003chr9:
28281527-28281527
GAintronicDe novo--Trost2022 G
LINGO2     SJD_50.4chr9:
28290324-28290324
GAintronicDe novo--Trost2022 G
LINGO2     2-0014-003chr9:
28246926-28246931
TTTTTCCATCAAintronicDe novo--Trost2022 G
LINGO2     5-0123-003chr9:
30174507-30174507
ATintergenicDe novo--Yuen2017 G
LINGO2     MSSNG00366-004chr9:
28273154-28273154
ATintronicDe novo--Trost2022 G
LINGO2     4-0062-003chr9:
28220134-28220136
TATATAintronicDe novo--Trost2022 G
LINGO2     2-1529-003chr9:
29346097-29346097
CTintergenicDe novo--Yuen2017 G
LINGO2     1-0677-004Achr9:
28221582-28221582
GCintronicDe novo--Trost2022 G
LINGO2     2-1529-003chr9:
29207131-29207144
AATATATATATATAAATATATATATAintronicDe novo--Yuen2017 G
LINGO2     3-0059-000chr9:
28208386-28208386
CTintronicDe novo--Trost2022 G
LINGO2     AU4054301chr9:
29462173-29462173
TCintergenicDe novo--Yuen2017 G
LINGO2     MSSNG00109-004chr9:
28218118-28218118
AGintronicDe novo--Trost2022 G
LINGO2     3-0221-000chr9:
28343513-28343513
CTintronicDe novo--Trost2022 G
LINGO2     SJD_8.3chr9:
28355069-28355069
TCintronicDe novo--Trost2022 G
LINGO2     1-0652-003chr9:
28976920-28976920
TCintronicDe novo--Trost2022 G
Yuen2017 G
LINGO2     7-0081-003chr9:
28320542-28320542
CGintronicDe novo--Trost2022 G
LINGO2     AU004403chr9:
28326316-28326316
ATintronicDe novo--Trost2022 G
LINGO2     2-1823-003chr9:
28315554-28315554
TGintronicDe novo--Trost2022 G
LINGO2     MSSNG00085-003chr9:
28319296-28319296
CTintronicDe novo--Trost2022 G
LINGO2     1-1024-003chr9:
28302621-28302621
AGintronicDe novo--Trost2022 G
LINGO2     SJD_63.3chr9:
28309244-28309244
GAintronicDe novo--Trost2022 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More