or
or
Exact

Results for "IGSF11"

Variant Events: 30

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
IGSF11     AU2165301 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
IGSF11     AU4283301chr3:
118773801-118773801
CTintronicDe novo--Trost2022 G
Yuen2017 G
IGSF11     2-1137-003chr3:
118789109-118789109
CTintronicDe novo--Yuen2016 G
IGSF11     AU0540301chr3:
118669120-118669120
GAintronicDe novo--Trost2022 G
Yuen2017 G
IGSF11     5-0133-003chr3:
118780221-118780221
CTintronicDe novo--Trost2022 G
Yuen2017 G
IGSF11     5-0133-003chr3:
118785114-118785114
CGintronicDe novo--Trost2022 G
Yuen2017 G
IGSF11     1-0104-003chr3:
118737063-118737063
GGATAGAGGTintronicDe novo--Trost2022 G
Yuen2017 G
IGSF11     1-0539-003chr3:
118718025-118718025
GAintronicDe novo--Trost2022 G
Yuen2017 G
IGSF11     7-0250-003chr3:
118852669-118852669
AGintronicDe novo--Yuen2017 G
IGSF11     2-1506-003chr3:
118842505-118842522
CAGAGAGAGAGAGAGAGACAGAGAGAGAGAGAGAintronicDe novo--Yuen2017 G
IGSF11     AU070007chr3:
118786253-118786253
CGintronicDe novo--Trost2022 G
Yuen2017 G
IGSF11     5-0138-003chr3:
118797654-118797654
ACintronicDe novo--Trost2022 G
Yuen2017 G
IGSF11     2-0244-003chr3:
118652722-118652742
CTCCTGTCAGTTTAGAGGAGTCintronicDe novo--Trost2022 G
Yuen2017 G
IGSF11     AU4343302chr3:
118846706-118846706
GTintronicDe novo--Trost2022 G
Yuen2017 G
IGSF11     2-1152-003chr3:
118763962-118763962
GAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
IGSF11     2-1280-003chr3:
118630568-118630601
CAGAGAGAGAGAGAGAGAAAGAGAGAGAGAGAGACAGAGAGAGAGAGAGAAAGAGAGAGAGAGAGAintronicDe novo--Yuen2017 G
IGSF11     3-0099-001Achr3:
118702557-118702557
TCintronicDe novo--Trost2022 G
IGSF11     3-0113-000chr3:
118717259-118717259
TCintronicDe novo--Trost2022 G
IGSF11     MSSNG00395-003chr3:
118672114-118672114
TCintronicDe novo--Trost2022 G
IGSF11     1-0160-004chr3:
118701782-118701782
TGAintronicDe novo--Trost2022 G
IGSF11     REACH000738chr3:
118630535-118630535
AGintronicDe novo--Trost2022 G
IGSF11     2-1132-003chr3:
118673412-118673412
GTintronicDe novo--Trost2022 G
Yuen2017 G
IGSF11     1-1137-003chr3:
118858485-118858485
AGintronicDe novo--Trost2022 G
IGSF11     SP0100556chr3:
118624498-118624498
CGexonicDe novosynonymous SNVNM_001015887
NM_152538
c.G648C
c.G645C
p.V216V
p.V215V
--Fu2022 E
Trost2022 G
Zhou2022 GE
IGSF11     3-0833-000chr3:
118830056-118830056
CGintronicDe novo--Trost2022 G
IGSF11     7-0250-003Achr3:
118852669-118852669
AGintronicDe novo--Trost2022 G
IGSF11     1-0661-003chr3:
118792332-118792332
CTintronicDe novo--Trost2022 G
IGSF11     SJD_69.3chr3:
118823485-118823485
ATintronicDe novo--Trost2022 G
IGSF11     3-0783-000chr3:
118718136-118718136
AGintronicDe novo--Trost2022 G
IGSF11     SJD_50.3chr3:
118757193-118757193
TGintronicDe novo--Trost2022 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More