or
or
Exact

Results for "DCAF15"

Variant Events: 82

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
DCAF15     PN400490chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400564chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400352chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400534chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400170chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400498chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400117chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400246chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400194chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400523chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400289chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400372chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400434chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400455chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400281chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400587chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400323chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400232chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400543chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400565chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400150chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400182chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400125chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400410chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400209chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400220chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400348chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400260chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400499chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400171chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400568chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400266chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400457chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400488chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400375chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400439chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400118chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400306chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400590chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400341chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400256chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400544chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400493chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400560chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400282chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400361chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     AU153Achr19:
14070218-14070218
CGexonicDe novosynonymous SNVNM_138353c.C1146Gp.S382S--Satterstrom2020 E
DCAF15     PN400108chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400119chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400476chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400261chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400441chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400249chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400297chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400562chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400379chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400506chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400286chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400424chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400178chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400321chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400514chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400396chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400257chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400495chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400283chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400528chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400111chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400546chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400371chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400477chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400486chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400350chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400330chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400503chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400129chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400322chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400280chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400252chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400380chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400312chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
DCAF15     PN400431chr19:
14070706-14070706
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More