or
or
Exact

Results for "HERC2"

Variant Events: 81

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
HERC2     PN400103chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400366chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     12324.p1chr15:
28369345-28369345
GTexonicDe novosynonymous SNVNM_004667c.C13026Ap.P4342P--Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
HERC2     14243.p1chr15:
28506003-28506003
GAexonicDe novononsynonymous SNVNM_004667c.C2236Tp.R746C15.0-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
HERC2     PN400113chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400117chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400170chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400194chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400347chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400246chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400455chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400587chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400383chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400498chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     AU3951302chr15:
28565343-28565343
CAintronicDe novo--Yuen2017 G
HERC2     PN400491chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     11824.p1chr15:
28427543-28427543
GTintronicMosaic--Dou2017 E
HERC2     PN400434chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400305chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400517chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400410chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400367chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400543chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400209chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     1-0259-003chr15:
28514213-28514213
TAintronicDe novo--Yuen2017 G
HERC2     PN400359chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400348chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400266chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400457chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     Viggiano2022:22.3chr15:
28387515-28387515
GCexonicPaternalnonsynonymous SNVNM_004667c.C11569Gp.L3857V19.45-Viggiano2022 GT
HERC2     PN400118chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400385chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400551chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400277chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400394chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     AU076509chr15:
28361136-28361136
TCintronicDe novo--Yuen2017 G
HERC2     PN400292chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     Viggiano2022:22.4chr15:
28387515-28387515
GCexonicPaternalnonsynonymous SNVNM_004667c.C11569Gp.L3857V19.45-Viggiano2022 GT
HERC2     AU4079301chr15:
28561386-28561422
AAAAAAAAGGAATTGTCATCAAAGTCCTACGGCTAAAAAAAintronicDe novo--Yuen2017 G
HERC2     11521.p1chr15:
28460913-28460913
GAexonicDe novononsynonymous SNVNM_004667c.C6064Tp.R2022W18.011.728E-5Ji2016 E
HERC2     DEASD_0043_002chr15:
28377973-28377973
CTexonicDe novosynonymous SNVNM_004667c.G12234Ap.P4078P-2.571E-5DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
HERC2     PN400213chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400518chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400157chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400361chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400412chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400203chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400506chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400267chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     Lim2017:68687chr15:
28369345-28369345
GTexonicDe novosynonymous SNVNM_004667c.C13026Ap.P4342P--Lim2017 E
HERC2     PN400128chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400441chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     Lim2017:36050chr15:
28506003-28506003
GAexonicDe novononsynonymous SNVNM_004667c.C2236Tp.R746C15.0-Lim2017 E
HERC2     PN400286chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400514chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400127chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400178chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400321chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400396chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400554chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400262chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400363chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400495chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400283chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400533chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400166chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400415chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     DEASD_1048_001chr15:
28473359-28473359
CTintronicDe novo--Satterstrom2020 E
HERC2     PN400371chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400190chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400102chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400116chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     2-1427-003chr15:
28520495-28520495
GCintronicDe novo--Yuen2017 G
HERC2     1-0405-003chr15:
28411298-28411298
GAintronicDe novo--Yuen2017 G
HERC2     21969-37814chr15:
28422649-28422649
CTexonicInheritednonsynonymous SNVNM_004667c.G9170Ap.R3057Q37.0-Callaghan2019 G
HERC2     AU2975301chr15:
28561169-28561169
GAintronicDe novo--Yuen2017 G
HERC2     PN400490chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400252chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400312chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400280chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HERC2     PN400205chr15:
28518114-28518115
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More