or
or
Exact

Results for "SDHA"

Variant Events: 22

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SDHA     PN400514chr5:
256483-256485
CTTCexonicUnknownframeshift deletionNM_001294332
NM_004168
c.1800_1801del
c.1944_1945del
p.T600fs
p.T648fs
-0.0135Leblond2019 E
SDHA     PN400305chr5:
256483-256485
CTTCexonicUnknownframeshift deletionNM_001294332
NM_004168
c.1800_1801del
c.1944_1945del
p.T600fs
p.T648fs
-0.0135Leblond2019 E
SDHA     SSC08246chr5:
251135-251135
GAexonicDe novononsynonymous SNVNM_001294332
NM_004168
c.G1436A
c.G1580A
p.R479H
p.R527H
19.83.295E-5Lim2017 E
SDHA     PN400292chr5:
256483-256485
CTTCexonicUnknownframeshift deletionNM_001294332
NM_004168
c.1800_1801del
c.1944_1945del
p.T600fs
p.T648fs
-0.0135Leblond2019 E
SDHA     PN400590chr5:
256483-256485
CTTCexonicUnknownframeshift deletionNM_001294332
NM_004168
c.1800_1801del
c.1944_1945del
p.T600fs
p.T648fs
-0.0135Leblond2019 E
SDHA     PN400581chr5:
256483-256485
CTTCexonicUnknownframeshift deletionNM_001294332
NM_004168
c.1800_1801del
c.1944_1945del
p.T600fs
p.T648fs
-0.0135Leblond2019 E
SDHA     PN400341chr5:
256483-256485
CTTCexonicUnknownframeshift deletionNM_001294332
NM_004168
c.1800_1801del
c.1944_1945del
p.T600fs
p.T648fs
-0.0135Leblond2019 E
SDHA     PN400282chr5:
256483-256485
CTTCexonicUnknownframeshift deletionNM_001294332
NM_004168
c.1800_1801del
c.1944_1945del
p.T600fs
p.T648fs
-0.0135Leblond2019 E
SDHA     PN400532chr5:
256483-256485
CTTCexonicUnknownframeshift deletionNM_001294332
NM_004168
c.1800_1801del
c.1944_1945del
p.T600fs
p.T648fs
-0.0135Leblond2019 E
SDHA     PN400439chr5:
256483-256485
CTTCexonicUnknownframeshift deletionNM_001294332
NM_004168
c.1800_1801del
c.1944_1945del
p.T600fs
p.T648fs
-0.0135Leblond2019 E
SDHA     2-1434-003chr5:
263052-263061
TTTTTGTTTTTTTTTintergenicDe novo--Yuen2017 G
SDHA     PN400489chr5:
256483-256485
CTTCexonicUnknownframeshift deletionNM_001294332
NM_004168
c.1800_1801del
c.1944_1945del
p.T600fs
p.T648fs
-0.0135Leblond2019 E
SDHA     PN400182chr5:
256483-256485
CTTCexonicUnknownframeshift deletionNM_001294332
NM_004168
c.1800_1801del
c.1944_1945del
p.T600fs
p.T648fs
-0.0135Leblond2019 E
SDHA     13504.p1chr5:
251135-251135
GAexonicDe novononsynonymous SNVNM_001294332
NM_004168
c.G1436A
c.G1580A
p.R479H
p.R527H
19.83.295E-5Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
SDHA     PN400116chr5:
256483-256485
CTTCexonicUnknownframeshift deletionNM_001294332
NM_004168
c.1800_1801del
c.1944_1945del
p.T600fs
p.T648fs
-0.0135Leblond2019 E
SDHA     PN400103chr5:
256483-256485
CTTCexonicUnknownframeshift deletionNM_001294332
NM_004168
c.1800_1801del
c.1944_1945del
p.T600fs
p.T648fs
-0.0135Leblond2019 E
SDHA     12225.p1chr5:
230941-230941
GGCCGCTGGATCTCACCAGATAintronicDe novo--Satterstrom2020 E
SDHA     PN400495chr5:
256483-256485
CTTCexonicUnknownframeshift deletionNM_001294332
NM_004168
c.1800_1801del
c.1944_1945del
p.T600fs
p.T648fs
-0.0135Leblond2019 E
SDHA     PN400551chr5:
256483-256485
CTTCexonicUnknownframeshift deletionNM_001294332
NM_004168
c.1800_1801del
c.1944_1945del
p.T600fs
p.T648fs
-0.0135Leblond2019 E
SDHA     PN400125chr5:
256483-256485
CTTCexonicUnknownframeshift deletionNM_001294332
NM_004168
c.1800_1801del
c.1944_1945del
p.T600fs
p.T648fs
-0.0135Leblond2019 E
SDHA     PN400249chr5:
256483-256485
CTTCexonicUnknownframeshift deletionNM_001294332
NM_004168
c.1800_1801del
c.1944_1945del
p.T600fs
p.T648fs
-0.0135Leblond2019 E
SDHA     PN400470chr5:
256483-256485
CTTCexonicUnknownframeshift deletionNM_001294332
NM_004168
c.1800_1801del
c.1944_1945del
p.T600fs
p.T648fs
-0.0135Leblond2019 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More