or
or
Exact

Results for "CYFIP1"

Variant Events: 9

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CYFIP1     7-0102-003chr15:
22989099-22989099
CTintronicDe novo--Yuen2017 G
CYFIP1     F10154-1chr15:
22991178-22991178
TGexonicDe novononsynonymous SNVNM_001033028
NM_014608
NM_001287810
c.T1574G
c.T2867G
c.T2867G
p.M525R
p.M956R
p.M956R
28.5-Satterstrom2020 E
CYFIP1     02C11650chr15:
22956307-22956307
GCexonicDe novononsynonymous SNVNM_001033028c.G251Cp.G84A9.083-Satterstrom2020 E
CYFIP1     Alvarez-Mora2016:ASD-15chr15:
22956343-22956343
CTexonicPaternalnonsynonymous SNVNM_001033028c.C287Tp.A96V9.7738.263E-5Alvarez-Mora2016 T
CYFIP1     MT_109chr15:
22969287-22969287
GCexonicMaternalnonsynonymous SNVNM_001033028
NM_014608
NM_001287810
c.G1220C
c.G2513C
c.G2513C
p.R407T
p.R838T
p.R838T
27.3-Toma2013 E
CYFIP1     AU039304chr15:
22981623-22981642
CTTTTTATTTTTTATTTTTTCTTTTTATTTTTTATTTTTTATTTTTTintronicDe novo--Yuen2017 G
CYFIP1     Codina-Sola2015:ASD_26chr15:
22956139-22956139
CTexonicPaternalnonsynonymous SNVNM_001033028c.C83Tp.T28M15.484.916E-5Codina-Sola2015 E
CYFIP1     2-1152-003chr15:
22909711-22909711
CTintronicDe novo--Yuen2016 G
Yuen2017 G
CYFIP1     5-0088-003chr15:
22923028-22923028
TCintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More