or
or
Exact

Results for "TCERG1L"

Variant Events: 48

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TCERG1L     1-0303-003chr10:
132891737-132891737
CTintronicDe novo--Yuen2017 G
TCERG1L     1-0563-004chr10:
133522779-133522779
TAintergenicDe novo--Yuen2017 G
TCERG1L     2-1371-003chr10:
133532707-133532707
GCintergenicDe novo--Yuen2016 G
Yuen2017 G
TCERG1L     AU2123302chr10:
133106179-133106179
CAintronicDe novo--Yuen2017 G
TCERG1L     2-0013-003chr10:
133209227-133209227
GAintergenicDe novo--Yuen2017 G
TCERG1L     EGAN00001101080chr10:
133058648-133058654
CGGCGGTCexonicDe novononframeshift deletionNM_174937c.724_729delp.242_243del--Satterstrom2020 E
TCERG1L     2-1146-003chr10:
133540750-133540750
GAintergenicDe novo--Yuen2017 G
TCERG1L     2-1250-003chr10:
133327185-133327185
ATintergenicDe novo--Yuen2017 G
TCERG1L     AU3506303chr10:
133285002-133285010
ACATGTATGAintergenicDe novo--Yuen2017 G
TCERG1L     2-1406-003chr10:
133542306-133542319
GACACACACACACAGACACACACACAintergenicDe novo--Yuen2017 G
TCERG1L     3-0458-000Bchr10:
133244178-133244178
CTintergenicDe novo--Yuen2017 G
TCERG1L     AU3052303chr10:
133218312-133218312
AGintergenicDe novo--Yuen2017 G
TCERG1L     2-0285-004chr10:
133145522-133145522
CCTTTCTintergenicDe novo--Yuen2017 G
TCERG1L     AU038204chr10:
133086123-133086123
GAintronicDe novo--Yuen2017 G
TCERG1L     2-0289-004chr10:
133217583-133217583
GAintergenicDe novo--Yuen2017 G
TCERG1L     1-0458-003chr10:
133522840-133522840
CTintergenicDe novo--Yuen2017 G
TCERG1L     JASD_Fam0021chr10:
133109867-133109867
CTexonicDe novononsynonymous SNVNM_174937c.G32Ap.R11Q8.017-Takata2018 E
TCERG1L     1-0290-003chr10:
133310938-133310938
TTGintergenicDe novo--Yuen2017 G
TCERG1L     1-0007-003chr10:
132974707-132974707
GAintronicDe novo--Yuen2017 G
TCERG1L     AU3849303chr10:
133317424-133317424
GAintergenicDe novo--Yuen2017 G
TCERG1L     1-0007-003chr10:
133518784-133518814
TTCTCTCTCTCTCTCTGTCTCTCTCTCTCTCTTCTCTCTCTCTCTGTCTCTCTCTCTCTCintergenicDe novo--Yuen2017 G
TCERG1L     13143.p1chr10:
132890047-132890047
CTdownstreamDe novo--Wilfert2021 G
TCERG1L     AU057405chr10:
132917761-132917761
AGintronicDe novo--Yuen2017 G
TCERG1L     13730.p1chr10:
132915185-132915185
GAexonicDe novosynonymous SNVNM_174937c.C1272Tp.C424C-8.0E-4Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
TCERG1L     2-1330-003chr10:
133315246-133315246
CGintergenicDe novo--Yuen2016 G
Yuen2017 G
TCERG1L     13570.p1chr10:
132965064-132965064
TCexonicMosaic Mat., De novononsynonymous SNVNM_174937c.A941Gp.D314G8.341-Dou2017 E
Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
TCERG1L     1-0978-003chr10:
133367328-133367328
CTintergenicDe novo--Yuen2017 G
TCERG1L     2-1322-003chr10:
133072165-133072165
GAintronicDe novo--Yuen2017 G
TCERG1L     1-0006-004chr10:
133310910-133310910
GGTTGTATintergenicDe novo--Yuen2017 G
TCERG1L     AU4372309chr10:
133024563-133024563
CGintronicDe novo--Yuen2017 G
TCERG1L     SSC08103chr10:
132965064-132965064
TCexonicDe novononsynonymous SNVNM_174937c.A941Gp.D314G8.341-Lim2017 E
TCERG1L     1-0142-005chr10:
133522836-133522836
CCAATCACACTCAintergenicDe novo--Yuen2017 G
TCERG1L     2-1180-003chr10:
132965082-132965082
CTexonicDe novononsynonymous SNVNM_174937c.G923Ap.R308Q2.5172.493E-5Yuen2016 G
Yuen2017 G
TCERG1L     AU3874301chr10:
132974866-132974871
CAGAGACAGAintronicDe novo--Yuen2017 G
TCERG1L     2-1246-003chr10:
133448168-133448168
GGTGATGGATGCACAGGTGTATGGAGGCGCAGAintergenicDe novo--Yuen2017 G
TCERG1L     2-1629-003chr10:
133324666-133324666
AGintergenicDe novo--Yuen2017 G
TCERG1L     5-0106-003chr10:
133133607-133133607
GTintergenicDe novo--Yuen2017 G
TCERG1L     2-1339-003chr10:
133112865-133112865
CTintergenicDe novo--Yuen2017 G
TCERG1L     2-1451-004chr10:
133071685-133071685
GAintronicDe novo--Yuen2017 G
TCERG1L     AU4024303chr10:
133330730-133330730
GAintergenicDe novo--Yuen2017 G
TCERG1L     3-0458-000chr10:
133244178-133244178
CTintergenicDe novo--Yuen2016 G
TCERG1L     2-1644-003chr10:
133522840-133522840
CTintergenicDe novo--Yuen2017 G
TCERG1L     1-0158-012chr10:
133310645-133310645
TTGCintergenicDe novo--Yuen2017 G
TCERG1L     3-0307-000chr10:
133469928-133469928
TCintergenicDe novo--Yuen2017 G
TCERG1L     iHART1606chr10:
132944925-132944925
TGsplicingPaternalsplicing19.11-Ruzzo2019 G
TCERG1L     1-0539-003chr10:
133310940-133310940
GGTGTintergenicDe novo--Yuen2017 G
TCERG1L     AU072505chr10:
133439139-133439139
CTintergenicDe novo--Yuen2017 G
TCERG1L     3-0458-000Achr10:
133244178-133244178
CTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More