or
or
Exact

Results for "NSD1"

Variant Events: 25

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
NSD1     ASC_CA_135_Achr5:
176636804-176636804
TAexonicDe novononsynonymous SNVNM_022455
NM_172349
c.T1404A
c.T597A
p.H468Q
p.H199Q
10.03-Fu2022 E
Satterstrom2020 E
NSD1     SP0136950chr5:
176562607-176562607
TCexonicDe novononsynonymous SNVNM_022455c.T503Cp.M168T10.7-Fu2022 E
NSD1     SP0105203chr5:
176636824-176636824
GAexonicDe novononsynonymous SNVNM_022455
NM_172349
c.G1424A
c.G617A
p.C475Y
p.C206Y
17.05-Fu2022 E
NSD1     SP0051671chr5:
176719125-176719125
CTexonicDe novosynonymous SNVNM_022455
NM_172349
c.C6429T
c.C5622T
p.H2143H
p.H1874H
-9.921E-5Fu2022 E
NSD1     2-1154-003chr5:
176634924-176634940
CGTGTGTGTGTGTGTGTCGTGTGTGTGTGTGTintronicDe novo--Yuen2017 G
NSD1     SP0105324chr5:
176637619-176637619
AGexonicDe novononsynonymous SNVNM_022455
NM_172349
c.A2219G
c.A1412G
p.H740R
p.H471R
0.001-Fu2022 E
NSD1     3-0447-000chr5:
176576691-176576691
CTintronicDe novo--Yuen2016 G
Yuen2017 G
NSD1     Li2017:19568chr5:
176678737-176678737
GAexonicUnknownnonsynonymous SNVNM_022455
NM_172349
c.G4648A
c.G3841A
p.E1550K
p.E1281K
29.1-Li2017 T
NSD1     SP0018376chr5:
176562810-176562812
CAGCexonicInheritedframeshift deletionNM_022455c.707_708delp.Q236fs--Feliciano2019 E
NSD1     A1338Bchr5:
176721337-176721337
CTexonicDe novononsynonymous SNVNM_022455
NM_172349
c.C6968T
c.C6161T
p.A2323V
p.A2054V
10.18-Fu2022 E
NSD1     Li2017:17694chr5:
176662905-176662905
CTexonicUnknownnonsynonymous SNVNM_022455
NM_172349
c.C3880T
c.C3073T
p.P1294S
p.P1025S
21.41.652E-5Li2017 T
NSD1     13143.p1chr5:
176639097-176639097
CTexonicDe novononsynonymous SNVNM_022455
NM_172349
c.C3697T
c.C2890T
p.R1233W
p.R964W
12.18.242E-6Wilfert2021 G
NSD1     1-0329-004chr5:
176723203-176723203
GAUTR3De novo--Yuen2017 G
NSD1     2-0011-004chr5:
176693255-176693255
CTintronicDe novo--Yuen2017 G
NSD1     AU0146302chr5:
176574129-176574129
CTintronicDe novo--Yuen2017 G
NSD1     AU070007chr5:
176658274-176658274
CTintronicDe novo--Yuen2017 G
NSD1     Lee2020:136chr5:
176719045-176719045
CTexonicstopgainNM_022455
NM_172349
c.C6349T
c.C5542T
p.R2117X
p.R1848X
45.0-Lee2020 T
NSD1     EGAN00001101115chr5:
176719132-176719132
TCexonicDe novononsynonymous SNVNM_022455
NM_172349
c.T6436C
c.T5629C
p.C2146R
p.C1877R
26.6-Fu2022 E
Satterstrom2020 E
NSD1     AU3646301chr5:
176562845-176562845
CAexonicDe novononsynonymous SNVNM_022455c.C741Ap.S247R14.21-Yuen2017 G
NSD1     NDAR_INVJP219FCV_wes1chr5:
176684041-176684041
TCexonicDe novononsynonymous SNVNM_022455
NM_172349
c.T4855C
c.T4048C
p.C1619R
p.C1350R
23.1-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
NSD1     2-1281-003chr5:
176716889-176716889
CTintronicDe novo--Yuen2017 G
NSD1     1-0675-003chr5:
176612459-176612459
CTintronicDe novo--Yuen2017 G
NSD1     Yalcintepe2021:11chr5:
176631127-176631127
AGexonicnonsynonymous SNVNM_022455
NM_172349
c.A1070G
c.A263G
p.N357S
p.N88S
13.058.24E-6Yalcintepe2021 T
NSD1     1-0184-003chr5:
176636718-176636718
CTexonicDe novostopgainNM_022455
NM_172349
c.C1318T
c.C511T
p.R440X
p.R171X
13.64-Yuen2017 G
NSD1     A29chr5:
176670310-176670310
CTintronicDe novo--Wu2018 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More