or
or
Exact

Results for "ADAMTS2"

Variant Events: 32

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ADAMTS2     1-0067-004chr5:
178644761-178644761
AAGintronicDe novo--Yuen2017 G
ADAMTS2     7-0102-003chr5:
178646797-178646797
TCintronicDe novo--Yuen2017 G
ADAMTS2     2-0202-003chr5:
178644849-178644849
TTAGGGGATGGTGCAAGGGGGGATGGGCAintronicDe novo--Yuen2017 G
ADAMTS2     AU0146301chr5:
178918388-178918388
CTintergenicDe novo--Yuen2017 G
ADAMTS2     AU066404chr5:
178660052-178660052
CTintronicDe novo--Yuen2017 G
ADAMTS2     AU024105chr5:
178708900-178708902
TAATAintronicDe novo--Yuen2017 G
ADAMTS2     7-0253-004chr5:
178945583-178945583
CAintergenicDe novo--Yuen2017 G
ADAMTS2     7-0082-003chr5:
178644769-178644770
TGTintronicDe novo--Yuen2017 G
ADAMTS2     1-0579-003chr5:
178616496-178616496
CAintronicDe novo--Yuen2017 G
ADAMTS2     2-1242-003chr5:
178733371-178733371
CTintronicDe novo--Yuen2016 G
ADAMTS2     2-1441-003chr5:
178721671-178721671
GAintronicDe novo--Yuen2016 G
Yuen2017 G
ADAMTS2     AU4372309chr5:
178764307-178764307
CAintronicDe novo--Yuen2017 G
ADAMTS2     1-0555-003chr5:
178644769-178644770
TGTintronicDe novo--Yuen2017 G
ADAMTS2     1-0253-005chr5:
178803491-178803491
CGintergenicDe novo--Yuen2017 G
ADAMTS2     11252.p1chr5:
178552196-178552196
CTintronicDe novo-5.027E-5Krumm2015 E
Satterstrom2020 E
Turner2016 G
ADAMTS2     2-1562-004chr5:
178606545-178606545
CCCTTintronicDe novo--Yuen2017 G
ADAMTS2     2-0003-004chr5:
178785837-178785837
GCintergenicDe novo--Yuen2017 G
ADAMTS2     1-0486-003chr5:
178694275-178694275
GAintronicDe novo--Yuen2017 G
ADAMTS2     AU071703chr5:
178893855-178893855
CTintergenicDe novo--Yuen2017 G
ADAMTS2     AU4173301chr5:
178688682-178688682
GAintronicDe novo--Yuen2017 G
ADAMTS2     152-HSC0079chr5:
178553060-178553060
CTexonicInheritednonsynonymous SNVNM_014244c.G2689Ap.A897T2.4754.978E-5Patowary2019 E
ADAMTS2     2-0171-003chr5:
178621417-178621417
GCintronicDe novo--Yuen2017 G
ADAMTS2     AU1635302chr5:
178630638-178630638
GAintronicDe novo--Yuen2017 G
ADAMTS2     2-1220-003chr5:
178908928-178908928
TCintergenicDe novo--Yuen2017 G
ADAMTS2     1-0346-004chr5:
178866128-178866128
CTintergenicDe novo--Yuen2017 G
ADAMTS2     2-1178-003chr5:
178631444-178631444
CTintronicDe novo--Yuen2016 G
Yuen2017 G
ADAMTS2     1-0253-004chr5:
178803491-178803491
CGintergenicDe novo--Yuen2017 G
ADAMTS2     5-0109-003chr5:
178936965-178936965
CGintergenicDe novo--Yuen2017 G
ADAMTS2     2-0305-003chr5:
178636530-178636530
CCATGTintronicDe novo--Yuen2017 G
ADAMTS2     2-1255-003chr5:
178823157-178823157
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
ADAMTS2     13063.p1chr5:
178559204-178559204
GAintronicDe novo-8.439E-6Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
ADAMTS2     2-1379-003chr5:
178649090-178649090
TCintronicDe novo--Yuen2016 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More