or
or
Exact

Results for "ZMYM5"

Variant Events: 13

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ZMYM5     11572.p1chr13:
20479291-20479291
AGintergenicDe novo--Turner2016 G
ZMYM5     2-1477-003chr13:
20457890-20457905
GTATATATATATATATGTATATATATATATintergenicDe novo--Yuen2017 G
ZMYM5     1-0629-003chr13:
20474851-20474871
AAATAATAATAATAATAATAAAAATAATAATAATAATAAintergenicDe novo--Yuen2017 G
ZMYM5     A24chr13:
20521833-20521833
CAintergenicDe novo--Wu2018 G
ZMYM5     60-4031chr13:
20413118-20413118
CGexonicInheritednonsynonymous SNVNM_001039650
NM_001142684
c.G594C
c.G594C
p.W198C
p.W198C
12.84-Patowary2019 E
ZMYM5     A24 Complex Event; expand row to view variants  De novo--Wu2018 G
Wu2018 G
ZMYM5     1-0994-003chr13:
20474851-20474871
AAATAATAATAATAATAATAAAAATAATAATAATAATAAintergenicDe novo--Yuen2017 G
ZMYM5     AU4228302chr13:
20409168-20409168
GAintronicDe novo--Yuen2017 G
ZMYM5     2-1128-003chr13:
20438176-20438176
CAupstreamDe novo--Yuen2016 G
ZMYM5     GAU0046Cchr13:
20411805-20411805
TCexonicDe novosynonymous SNVNM_001039650
NM_001142684
c.A1029G
c.A1029G
p.K343K
p.K343K
--Lim2017 E
Satterstrom2020 E
ZMYM5     2-0142-003chr13:
20415124-20415124
CTintronicDe novo--Yuen2017 G
ZMYM5     1-0976-003chr13:
20491087-20491087
ATintergenicDe novo--Yuen2017 G
ZMYM5     AU3861302chr13:
20418831-20418831
GAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More