or
or
Exact

Results for "EYA2"

Variant Events: 19

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
EYA2     2-1364-003chr20:
45779228-45779228
TCintronicDe novo--Yuen2017 G
EYA2     2-1245-003chr20:
45625291-45625291
CGintronicDe novo--Yuen2017 G
EYA2     1-0210-004chr20:
45830076-45830076
TCintergenicDe novo--Yuen2017 G
EYA2     1-0488-003chr20:
45750010-45750010
GAintronicDe novo--Yuen2017 G
EYA2     1-0534-004chr20:
45794119-45794119
CTintronicDe novo--Yuen2017 G
EYA2     2-1455-003chr20:
45667223-45667237
CTGTGTGTGTGTGTGCTGTGTGTGTGTGintronicDe novo--Yuen2017 G
EYA2     1-0139-005chr20:
45753386-45753386
TGintronicDe novo--Yuen2017 G
EYA2     2-1352-003chr20:
45823968-45823968
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
EYA2     1-0299-003chr20:
45672392-45672392
AGintronicDe novo--Yuen2017 G
EYA2     2-0305-003chr20:
45780638-45780639
GAGintronicDe novo--Yuen2017 G
EYA2     1-1004-003chr20:
45701500-45701500
TCintronicDe novo--Yuen2017 G
EYA2     60-1015chr20:
45644877-45644877
AGexonicInheritednonsynonymous SNVNM_005244
NM_172110
c.A356G
c.A356G
p.Y119C
p.Y119C
19.446.589E-5Patowary2019 E
EYA2     1-0972-003chr20:
45729327-45729327
CTintronicDe novo--Yuen2017 G
EYA2     2-1089-004chr20:
45712800-45712800
GAintronicDe novo--Yuen2017 G
EYA2     A12chr20:
45780906-45780906
GAintronicDe novo--Wu2018 G
EYA2     2-1245-003chr20:
45614847-45614847
CTintronicDe novo--Yuen2017 G
EYA2     AU1725306chr20:
45645863-45645863
CAintronicDe novo--Yuen2017 G
EYA2     AU1725306chr20:
45646168-45646168
CTintronicDe novo--Yuen2017 G
EYA2     AU4032307chr20:
45574299-45574299
TCintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More