Variant Results

or

or

Results for "TUBGCP2"

Variant Events: 9

Gene Gene symbol on which the variant is located	ID Subject Identifier from the original study	Location Genomic location of the reference allele	REF Reference allele	ALT Alternate allele	Context Variant functional categories	Variant validation performed by an orthogonal method and reported	Inheritance Reported inheritance status	Effects Variant effect on transcript per Annovar	Transcript Transcript used for the cDNA/Protein mutation	cDNA cDNA variant notation	Protein Protein variant notation	CADD-Phred v1.0 CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores	ExAC v0.3 ExAC population frequency (version 0.3)	Sources Source(s) where variants from this event are reported
TUBGCP2	1-0324-003	chr10: 135092656-135092656	C	T	UTR3		De novo					-	-	Yuen2017 G
TUBGCP2	13083.p1	chr10: 135094766-135094766	C	T	intronic		De novo					-	-	Krumm2015 E
TUBGCP2	152-HSC0079	chr10: 135107082-135107082	A	T	exonic		Inherited	nonsynonymous SNV	NM_001256618 NM_006659 NM_001256617	c.T418A c.T808A c.T892A	p.Y140N p.Y270N p.Y298N	22.2	5.173E-5	Patowary2019 E
TUBGCP2	1-0862-003	chr10: 135121113-135121113	G	GTGC	intronic		De novo					-	-	Yuen2017 G
TUBGCP2	1000225657046492-C	chr10: 135099090-135099090	C	T	exonic		De novo	nonsynonymous SNV	NM_001256618 NM_006659 NM_001256617	c.G1375A c.G1765A c.G1849A	p.V459I p.V589I p.V617I	7.649	-	Fu2022 E
TUBGCP2	MR_1081_II	chr10: 135105979-135105979	T	TCCCCCATGTCCCTCCATGTC	intronic		De novo					-	-	Satterstrom2020 E
TUBGCP2	80001101460	chr10: 135101743-135101743	C	G	exonic		De novo	nonsynonymous SNV	NM_001256618 NM_006659 NM_001256617	c.G1222C c.G1612C c.G1696C	p.E408Q p.E538Q p.E566Q	34.0	-	Fu2022 E
TUBGCP2	607646776430-C1	chr10: 135101839-135101839	G	C	intronic		De novo					-	1.018E-5	Fu2022 E
TUBGCP2	DEASD_0383_001	chr10: 135106567-135106567	T	C	exonic		De novo	nonsynonymous SNV	NM_001256618 NM_006659 NM_001256617	c.A610G c.A1000G c.A1084G	p.T204A p.T334A p.T362A	18.51	-	DeRubeis2014 E Fu2022 E Kosmicki2017 E Lim2017 E Satterstrom2020 E

Source Variant Information

, -

Source:

Paper alias:

No records found.

Paper Information

Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count	The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notes	View
	More