or
or
Exact

Results for "AHRR"

Variant Events: 12

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
AHRR     2-1182-003chr5:
422895-422895
CGexonicDe novononsynonymous SNVNM_001242412
NM_020731
c.C505G
c.C505G
p.Q169E
p.Q169E
19.68-Jiang2013 G
Yuen2016 G
Yuen2017 G
AHRR     09C99813chr5:
422895-422895
CGexonicDe novononsynonymous SNVNM_001242412
NM_020731
c.C505G
c.C505G
p.Q169E
p.Q169E
19.68-Satterstrom2020 E
AHRR     11114.p1chr5:
376877-376877
CTintronicDe novo-2.0E-4Satterstrom2020 E
AHRR     1-0215-006chr5:
415341-415341
CTintronicDe novo--Yuen2017 G
AHRR     AU4473301chr5:
338794-338794
AGintronicDe novo--Yuen2017 G
AHRR     7-0095-004chr5:
433955-433955
CGintronicDe novo-2.005E-5Yuen2017 G
AHRR     AU039304chr5:
438413-438413
CTdownstreamDe novo--Yuen2017 G
AHRR     AU2495301chr5:
314210-314210
GAintronicDe novo--Yuen2017 G
AHRR     AU3399303chr5:
355058-355058
TGintronicDe novo--Yuen2017 G
AHRR     AU3712302chr5:
375638-375638
CTintronicDe novo--Yuen2017 G
AHRR     EGAN00001101049chr5:
368071-368071
AATGGGGGAGCTGATGTTGTTTTGAGAGCCGTGCAGCTGGAGATCCGGintronicDe novo--Satterstrom2020 E
AHRR     13874.p1chr5:
396908-396908
GCintronicDe novo--Turner2016 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More