or
or
Exact

Results for "MXRA5"

Variant Events: 12

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MXRA5     2-1343-003 Complex Event; expand row to view variants  De novo--Yuen2017 G
Yuen2017 G
MXRA5     AU4150301chrX:
3372192-3372192
TCintergenicDe novo--Yuen2017 G
MXRA5     Al-Mubarak2017:ASD-19chrX:
3261847-3261847
GAexonicUnknownnonsynonymous SNVNM_015419c.C28Tp.L10F14.89-Al-Mubarak2017 E
MXRA5     1-0073-003chrX:
3298351-3298351
TAintergenicDe novo--Yuen2017 G
MXRA5     AU1542303chrX:
3457108-3457108
TGintergenicDe novo--Yuen2017 G
MXRA5     AU1988302chrX:
3305806-3305815
GTATATATATGTATATATintergenicDe novo--Yuen2017 G
MXRA5     AU4024303chrX:
3509325-3509330
AAAGAAAAAintergenicDe novo--Yuen2017 G
MXRA5     AU2000302chrX:
3335246-3335256
CCTCCATCTCTCCTintergenicDe novo--Yuen2017 G
MXRA5     2-1280-003chrX:
3248358-3248358
TCexonicDe novononsynonymous SNVNM_015419c.A410Gp.N137S16.56-Jiang2013 G
Yuen2017 G
MXRA5     5-0103-003chrX:
3464969-3464991
GGGAAGGAAGGAAGGAAGGAAGGGGGAAGGAAGGAAGGAAGGintergenicDe novo--Yuen2017 G
MXRA5     AU056005chrX:
3488160-3488198
ATATATGTATATAATGTATATATGTATATATATGTATATATATATintergenicDe novo--Yuen2017 G
MXRA5     AU3398301chrX:
3488315-3488324
GTATATATATGTATATATintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More