or
or
Exact

Results for "KDM4C"

Variant Events: 126

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
KDM4C     AU1933302chr9:
7328159-7328159
TCintergenicDe novo--Yuen2017 G
KDM4C     2-1305-003chr9:
7630679-7630679
CGintergenicDe novo--Yuen2016 G
Yuen2017 G
KDM4C     5-0109-003chr9:
7246191-7246196
GAAAAAGAAAAAAintergenicDe novo--Yuen2017 G
KDM4C     SP0038516chr9:
7103817-7103817
TGexonicDe novononsynonymous SNVNM_001304340
NM_001304339
NM_015061
c.T1792G
c.T2557G
c.T2557G
p.W598G
p.W853G
p.W853G
15.76-Feliciano2019 E
Fu2022 E
Trost2022 G
Zhou2022 GE
KDM4C     2-1305-003chr9:
7633775-7633775
CGintergenicDe novo--Yuen2016 G
Yuen2017 G
KDM4C     2-1305-003chr9:
7634019-7634019
CGintergenicDe novo--Yuen2016 G
Yuen2017 G
KDM4C     2-0081-003chr9:
7056415-7056415
CGintronicDe novo--Trost2022 G
Yuen2017 G
KDM4C     2-1093-009chr9:
7097751-7097751
GCintronicDe novo--Trost2022 G
Yuen2017 G
KDM4C     2-1093-009chr9:
6850639-6850639
CGintronicDe novo--Trost2022 G
Yuen2017 G
KDM4C     5-0114-003chr9:
7613438-7613438
CAintergenicDe novo--Yuen2017 G
KDM4C     1-0290-003chr9:
7035289-7035289
TCintronicDe novo--Yuen2017 G
KDM4C     2-1089-004chr9:
7089839-7089839
GTintronicDe novo--Trost2022 G
Yuen2017 G
KDM4C     3-0428-000chr9:
7419674-7419674
TCintergenicDe novo--Yuen2017 G
KDM4C     2-0081-003chr9:
7666789-7666789
AGintergenicDe novo--Yuen2017 G
KDM4C     AU3997302chr9:
7596575-7596575
TGintergenicDe novo--Yuen2017 G
KDM4C     AU011903chr9:
7639717-7639717
TCintergenicDe novo--Yuen2017 G
KDM4C     SP0076503chr9:
6893052-6893052
AGintronicDe novo--Fu2022 E
KDM4C     1-0751-003chr9:
6819444-6819444
GTintronicDe novo--Trost2022 G
Yuen2017 G
KDM4C     2-1339-003chr9:
6723204-6723204
TCintronicDe novo--Trost2022 G
Yuen2017 G
KDM4C     1-0107-003chr9:
7575885-7575885
TCintergenicDe novo--Yuen2017 G
KDM4C     2-1142-003chr9:
7178164-7178164
GCintergenicDe novo--Yuen2017 G
KDM4C     AU3636301chr9:
7486199-7486199
TCintergenicDe novo--Yuen2017 G
KDM4C     2-0270-004chr9:
7791746-7791746
GTintergenicDe novo--Yuen2017 G
KDM4C     A3chr9:
7600649-7600649
CGintergenicDe novo--Wu2018 G
KDM4C     AU4173301chr9:
7748384-7748384
TCintergenicDe novo--Yuen2017 G
KDM4C     IGM10609chr9:
6849649-6849649
AGexonicDe novononsynonymous SNVNM_001304340
NM_001146695
NM_001146696
NM_001304339
NM_015061
c.A35G
c.A578G
c.A644G
c.A578G
c.A578G
p.D12G
p.D193G
p.D215G
p.D193G
p.D193G
27.1-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
KDM4C     5-0147-003chr9:
7256584-7256584
AGintergenicDe novo--Yuen2017 G
KDM4C     14249.p1chr9:
7130311-7130311
TCintronicUnknown--Werling2018 G
KDM4C     AU4173301chr9:
7186709-7186709
CTintergenicDe novo--Yuen2017 G
KDM4C     1-0162-004chr9:
6950814-6950814
CTintronicDe novo--Yuen2017 G
KDM4C     AU1988301chr9:
6850613-6850613
GAintronicDe novo--Trost2022 G
Yuen2017 G
KDM4C     2-1430-003chr9:
7377474-7377474
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
KDM4C     1-0534-006chr9:
7013361-7013373
TTCTTAAAGCCTCTintronicDe novo--Trost2022 G
Yuen2017 G
KDM4C     MT_160chr9:
6849673-6849673
AGexonicMaternalnonsynonymous SNVNM_001304340
NM_001146695
NM_001146696
NM_001304339
NM_015061
c.A59G
c.A602G
c.A668G
c.A602G
c.A602G
p.Y20C
p.Y201C
p.Y223C
p.Y201C
p.Y201C
23.8-Toma2013 E
KDM4C     AU3874303chr9:
6752923-6752923
CGintronicDe novo--Trost2022 G
Yuen2017 G
KDM4C     2-1436-003chr9:
7770126-7770126
CTintergenicDe novo--Yuen2017 G
KDM4C     3-0456-000chr9:
7368403-7368403
ATintergenicDe novo--Yuen2016 G
Yuen2017 G
KDM4C     3-0456-000Bchr9:
7368403-7368403
ATintergenicDe novo--Yuen2017 G
KDM4C     09C81774chr9:
7013744-7013744
CGintronicDe novo-9.0E-4Kosmicki2017 E
KDM4C     1-0874-003chr9:
7136184-7136184
CTintronicDe novo--Trost2022 G
Yuen2017 G
KDM4C     AU4060306chr9:
7219703-7219703
TGintergenicDe novo--Yuen2017 G
KDM4C     1-0303-003chr9:
7035265-7035265
TCintronicDe novo--Yuen2017 G
KDM4C     AU4006302chr9:
6857216-6857216
CGintronicDe novo--Trost2022 G
Yuen2017 G
KDM4C     1-0414-005chr9:
7365715-7365715
AGintergenicDe novo--Yuen2017 G
KDM4C     AU3368302chr9:
6961078-6961078
TCintronicDe novo--Trost2022 G
Yuen2017 G
KDM4C     7-0140-003chr9:
7618259-7618259
CGintergenicDe novo--Yuen2017 G
KDM4C     AU3951301chr9:
7266767-7266767
CTintergenicDe novo--Yuen2017 G
KDM4C     AU4485302chr9:
7433849-7433850
ACAintergenicDe novo--Yuen2017 G
KDM4C     1-0604-003chr9:
7434527-7434527
TCintergenicDe novo--Yuen2017 G
KDM4C     5-0148-003chr9:
7280799-7280799
CGintergenicDe novo--Yuen2017 G
KDM4C     2-0309-005chr9:
7292167-7292167
AGintergenicDe novo--Yuen2017 G
KDM4C     2-1480-003chr9:
6735384-6735384
GTintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
KDM4C     REACH000341chr9:
6720717-6720717
CGupstreamDe novo--Trost2022 G
KDM4C     1-0753-003chr9:
6759099-6759102
ACTTAintronicDe novo--Trost2022 G
KDM4C     5-0003-004chr9:
6793831-6793831
CTintronicDe novo--Trost2022 G
Yuen2017 G
KDM4C     1-0882-003chr9:
7547061-7547061
GCintergenicDe novo--Yuen2017 G
KDM4C     7-0294-003chr9:
6816677-6816677
CTintronicDe novo--Trost2022 G
KDM4C     2-1451-003chr9:
7197006-7197006
TCintergenicDe novo--Yuen2017 G
KDM4C     5-0512-005chr9:
6822102-6822102
GAintronicDe novo--Trost2022 G
KDM4C     AU3154301chr9:
6803524-6803524
TCintronicDe novo--Trost2022 G
KDM4C     MSSNG00023-003chr9:
6813998-6813998
TCintronicDe novo--Trost2022 G
KDM4C     3-0428-000chr9:
7560492-7560492
GCintergenicDe novo--Yuen2016 G
Yuen2017 G
KDM4C     REACH000219chr9:
6780458-6780458
ATintronicDe novo--Trost2022 G
KDM4C     AU2604301chr9:
6802962-6802962
CGintronicDe novo--Trost2022 G
KDM4C     3-0835-000chr9:
6760737-6760737
AATintronicDe novo--Trost2022 G
KDM4C     3-0428-000chr9:
7502062-7502062
GCintergenicDe novo--Yuen2016 G
Yuen2017 G
KDM4C     2-1723-003chr9:
6773941-6773941
TGintronicDe novo--Trost2022 G
KDM4C     AU4412302chr9:
7594212-7594212
GAintergenicDe novo--Yuen2017 G
KDM4C     REACH000145chr9:
6940339-6940339
CGintronicDe novo--Trost2022 G
KDM4C     REACH000145chr9:
6941519-6941519
CGintronicDe novo--Trost2022 G
KDM4C     3-0338-000chr9:
6897996-6897996
CTintronicDe novo--Trost2022 G
KDM4C     3-0515-001chr9:
6933206-6933206
GCintronicDe novo--Trost2022 G
KDM4C     7-0308-003chr9:
6891285-6891285
GAintronicDe novo--Trost2022 G
KDM4C     1-0969-003chr9:
6822238-6822238
CTintronicDe novo--Trost2022 G
Yuen2017 G
KDM4C     1-0202-003chr9:
6894794-6894794
AGintronicDe novo--Trost2022 G
KDM4C     MSSNG00212-003chr9:
6822617-6822617
GTintronicDe novo--Trost2022 G
KDM4C     7-0367-003chr9:
6833462-6833462
GAintronicDe novo--Trost2022 G
KDM4C     5-1009-003chr9:
7035257-7035257
TGintronicDe novo--Trost2022 G
KDM4C     3-0134-001chr9:
7035289-7035289
TCintronicDe novo--Trost2022 G
KDM4C     5-0003-004chr9:
7035257-7035257
TGintronicDe novo--Trost2022 G
KDM4C     2-1619-004chr9:
7035257-7035257
TGintronicDe novo--Trost2022 G
KDM4C     1-0566-003chr9:
7411340-7411340
ATintergenicDe novo--Yuen2017 G
KDM4C     AU3905301chr9:
7052970-7052970
AGintronicDe novo--Trost2022 G
Yuen2017 G
KDM4C     AU4239301chr9:
7355008-7355008
CAintergenicDe novo--Yuen2017 G
KDM4C     4-0004-003chr9:
7031360-7031360
CTintronicDe novo--Trost2022 G
KDM4C     2-1398-003chr9:
7035202-7035204
TGACGGintronicDe novo--Trost2022 G
KDM4C     1-0551-003chr9:
7455364-7455364
CTintergenicDe novo--Yuen2017 G
KDM4C     1-0644-003chr9:
6953805-6953805
CTintronicDe novo--Trost2022 G
KDM4C     MSSNG00346-004chr9:
6995124-6995124
ACintronicDe novo--Trost2022 G
KDM4C     1-1058-003chr9:
7154886-7154886
GAintronicDe novo--Trost2022 G
KDM4C     3-0410-000chr9:
7157088-7157088
CGintronicDe novo--Trost2022 G
KDM4C     4-0062-003chr9:
7125982-7125984
CCTGACintronicDe novo--Trost2022 G
KDM4C     1-0273-004chr9:
7290939-7290939
GCintergenicDe novo--Yuen2017 G
KDM4C     MSSNG00078-003chr9:
7127584-7127584
GAintronicDe novo--Trost2022 G
KDM4C     7-0178-003chr9:
7068043-7068043
GAintronicDe novo--Trost2022 G
KDM4C     7-0326-003chr9:
7106232-7106232
ACintronicDe novo--Trost2022 G
KDM4C     1-0763-004chr9:
7035289-7035289
TCintronicDe novo--Trost2022 G
KDM4C     3-0490-000chr9:
7064604-7064604
CTintronicDe novo--Trost2022 G
KDM4C     AU3808304chr9:
6971894-6971894
CTintronicDe novo--Trost2022 G
Yuen2017 G
KDM4C     13324.p1chr9:
7305179-7305179
AGintergenicDe novo--Turner2016 G
KDM4C     344-05-104641chr9:
7076480-7076480
ATUTR3De novo--Satterstrom2020 E
Trost2022 G
KDM4C     1-1121-003chr9:
7164425-7164425
AGintronicDe novo--Trost2022 G
KDM4C     13324.p1chr9:
7305669-7305669
CGintergenicDe novo--Turner2016 G
KDM4C     11194.p1chr9:
7516908-7516908
TAintergenicDe novo--Turner2016 G
KDM4C     AU1668302chr9:
7703493-7703493
GAintergenicDe novo--Yuen2017 G
KDM4C     AU4263304chr9:
7742568-7742568
CTintergenicDe novo--Yuen2017 G
KDM4C     2-0006-004chr9:
7194641-7194641
TCintergenicDe novo--Yuen2017 G
KDM4C     1-0269-005chr9:
6855783-6855783
ACintronicDe novo--Trost2022 G
Yuen2017 G
KDM4C     1-0269-005chr9:
7519992-7519992
CAintergenicDe novo--Yuen2017 G
KDM4C     2-1268-003chr9:
6840722-6840722
GAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
KDM4C     1-0534-004chr9:
7013361-7013373
TTCTTAAAGCCTCTintronicDe novo--Trost2022 G
Yuen2017 G
KDM4C     AU069603chr9:
7271710-7271710
ATintergenicDe novo--Yuen2017 G
KDM4C     1-0973-003chr9:
6914205-6914205
AGintronicDe novo--Trost2022 G
Yuen2017 G
KDM4C     1-0299-003chr9:
7035272-7035272
TCintronicDe novo--Yuen2017 G
KDM4C     2-1451-004chr9:
7245510-7245510
CTintergenicDe novo--Yuen2017 G
KDM4C     1-0186-004chr9:
7035272-7035272
TCintronicDe novo--Yuen2017 G
KDM4C     2-1430-003chr9:
7473140-7473158
TGAGAGAGAGAGAGAGAGATGAGAGAGAGAGAGAGAintergenicDe novo--Yuen2017 G
KDM4C     AU4479301chr9:
7518696-7518696
GAintergenicDe novo--Yuen2017 G
KDM4C     1-0699-003chr9:
7330612-7330612
GTintergenicDe novo--Yuen2017 G
KDM4C     1-0699-003chr9:
7186731-7186731
TGintergenicDe novo--Yuen2017 G
KDM4C     AU1725306chr9:
7519276-7519276
CTintergenicDe novo--Yuen2017 G
KDM4C     1-0446-003chr9:
7035265-7035265
TCintronicDe novo--Yuen2017 G
KDM4C     2-1715-003chr9:
6729852-6729852
AGintronicDe novo--Yuen2017 G
KDM4C     2-1720-003chr9:
7469964-7469966
CAACAAAintergenicDe novo--Yuen2017 G
KDM4C     AU4250301chr9:
6723412-6723412
CTintronicDe novo--Trost2022 G
Yuen2017 G
KDM4C     AU045010chr9:
6954288-6954288
CTintronicDe novo--Trost2022 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More