or
or
Exact

Results for "THSD4"

Variant Events: 93

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
THSD4     2-1337-003chr15:
71495324-71495324
CTintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
THSD4     SP0020134chr15:
71839782-71839782
CTexonicDe novononsynonymous SNVNM_001286429c.C34Tp.H12Y6.327-Fu2022 E
Zhou2022 GE
THSD4     SSC10463chr15:
72050341-72050341
CTexonicDe novononsynonymous SNVNM_001286429
NM_024817
c.C1436T
c.C2516T
p.P479L
p.P839L
32.0-Fu2022 E
Lim2017 E
Trost2022 G
THSD4     SP0091546chr15:
71704130-71704130
GAexonicDe novononsynonymous SNVNM_024817c.G1120Ap.G374S13.088.284E-6Fu2022 E
Trost2022 G
Zhou2022 GE
THSD4     7-0194-003chr15:
71547872-71547872
CAintronicDe novo--Yuen2017 G
THSD4     1-0674-003chr15:
71845464-71845464
GAintronicDe novo--Trost2022 G
Yuen2017 G
THSD4     1-0359-003chr15:
71577355-71577362
GTGTTGTTGTGTTintronicDe novo--Yuen2017 G
THSD4     AU3768302chr15:
71449549-71449549
GAintronicDe novo--Trost2022 G
Yuen2017 G
THSD4     2-0135-004chr15:
71562503-71562504
CACintronicDe novo--Yuen2017 G
THSD4     1-0022-004chr15:
71661736-71661736
ATintronicDe novo--Yuen2017 G
THSD4     1-0404-003chr15:
71961176-71961176
TGintronicDe novo--Trost2022 G
Yuen2017 G
THSD4     AU3703302chr15:
72064187-72064187
ACintronicDe novo--Trost2022 G
Yuen2017 G
THSD4     2-1352-003chr15:
71915643-71915643
CTintronicDe novo--Yuen2016 G
Yuen2017 G
THSD4     1-0028-003chr15:
71850989-71850989
TCintronicDe novo--Trost2022 G
Yuen2017 G
THSD4     1-0408-003chr15:
71944619-71944619
GAintronicDe novo--Yuen2016 G
Yuen2017 G
THSD4     AU3900301chr15:
71491826-71491845
GGGTGTGTGTGGTGTGTGTGGGGTGTGTGTGintronicDe novo--Yuen2017 G
THSD4     AU4264302chr15:
71455568-71455568
GTintronicDe novo--Yuen2017 G
THSD4     2-0159-003chr15:
71484910-71484910
CTintronicDe novo--Trost2022 G
THSD4     2-0307-003chr15:
71777350-71777350
GAintronicDe novo--Trost2022 G
Yuen2017 G
THSD4     2-1723-003chr15:
71493457-71493457
TCintronicDe novo--Trost2022 G
THSD4     1-1162-003chr15:
71483309-71483309
TAintronicDe novo--Trost2022 G
THSD4     1-0296-004chr15:
71576526-71576526
CGintronicDe novo--Trost2022 G
Yuen2017 G
THSD4     AU073006chr15:
71756304-71756304
CTintronicDe novo--Trost2022 G
Yuen2017 G
THSD4     1-0259-003chr15:
71818677-71818677
CTintronicDe novo--Trost2022 G
Yuen2017 G
THSD4     REACH000073chr15:
71569490-71569490
GTintronicDe novo--Trost2022 G
THSD4     AU4079301chr15:
71598683-71598683
TAintronicDe novo--Trost2022 G
THSD4     7-0413-003chr15:
71533534-71533534
AGintronicDe novo--Trost2022 G
THSD4     11883-1chr15:
72041054-72041054
AGintronicDe novo--Fu2022 E
THSD4     P2M7G_01chr15:
71541774-71541774
CAintronicDe novo--Trost2022 G
THSD4     Shi2013:1chr15:
71507377-71507377
CTexonicInheritednonsynonymous SNVNM_024817c.C103Tp.P35S15.659.0E-4Shi2013 G
THSD4     5-0140-003chr15:
71670310-71670310
CAintronicDe novo--Yuen2017 G
THSD4     MT_15.3chr15:
71526534-71526534
TCintronicDe novo--Trost2022 G
THSD4     5-0140-003chr15:
71672027-71672027
GAintronicDe novo--Trost2022 G
Yuen2017 G
THSD4     1-1183-003chr15:
71527449-71527449
CTintronicDe novo--Trost2022 G
THSD4     3-0742-000chr15:
71494993-71494993
GAintronicDe novo--Trost2022 G
THSD4     7-0307-003chr15:
71513793-71513793
GAintronicDe novo--Trost2022 G
THSD4     3-0709-000chr15:
71675915-71675915
GAintronicDe novo--Trost2022 G
THSD4     2-0273-003chr15:
71682606-71682613
ACACTTTCAintronicDe novo--Trost2022 G
THSD4     2-1798-003chr15:
71659953-71659953
TCintronicDe novo--Trost2022 G
THSD4     REACH000564chr15:
71665092-71665092
GAintronicDe novo--Trost2022 G
THSD4     MSSNG00354-004chr15:
71613272-71613272
TCintronicDe novo--Trost2022 G
THSD4     iHART1705chr15:
72030126-72030127
ACAexonicPaternalframeshift deletionNM_001286429
NM_024817
c.607delC
c.1687delC
p.Q203fs
p.Q563fs
--Ruzzo2019 G
THSD4     3-0533-000chr15:
71659574-71659574
ATintronicDe novo--Trost2022 G
THSD4     MSSNG00381-003chr15:
71609819-71609819
AGintronicDe novo--Trost2022 G
THSD4     MSSNG00381-003chr15:
71609838-71609838
ATintronicDe novo--Trost2022 G
THSD4     3-0847-000chr15:
71764521-71764521
GAintronicDe novo--Trost2022 G
THSD4     2-1261-003chr15:
71782348-71782351
ACAGGATTTintronicDe novo--Trost2022 G
THSD4     1-0494-003Achr15:
71733685-71733686
AGTCAintronicDe novo--Trost2022 G
THSD4     4-0064-003chr15:
71734047-71734050
TAAGTintronicDe novo--Trost2022 G
THSD4     REACH000443chr15:
71708612-71708612
CAintronicDe novo--Trost2022 G
THSD4     1-0246-004chr15:
71723878-71723878
CTintronicDe novo--Trost2022 G
Yuen2017 G
THSD4     5-5035-003chr15:
71730232-71730232
GAintronicDe novo--Trost2022 G
THSD4     2-1438-003chr15:
71702239-71702239
GGTintronicDe novo--Trost2022 G
THSD4     MT_37.3chr15:
71703932-71703932
ACintronicDe novo--Trost2022 G
THSD4     2-1817-003chr15:
71975524-71975524
GAintronicDe novo--Trost2022 G
THSD4     mAGRE1705chr15:
72030126-72030127
ACAexonicPaternalframeshift deletionNM_001286429
NM_024817
c.607delC
c.1687delC
p.Q203fs
p.Q563fs
--Cirnigliaro2023 G
THSD4     AU2458303chr15:
71750833-71750833
TCintronicDe novo--Trost2022 G
Yuen2017 G
THSD4     MSSNG00377-003chr15:
71976079-71976079
CTintronicDe novo--Trost2022 G
THSD4     mAGRE4936chr15:
72020930-72020930
GAexonicMaternalstopgainNM_001286429
NM_024817
c.G320A
c.G1400A
p.W107X
p.W467X
39.0-Cirnigliaro2023 G
THSD4     5-0025-004chr15:
71924685-71924690
ATGACCTTCCTTCTintronicDe novo--Trost2022 G
THSD4     3-0109-000chr15:
71934659-71934659
AGintronicDe novo--Trost2022 G
THSD4     AU3724302chr15:
71664984-71664984
GAintronicDe novo--Trost2022 G
Yuen2017 G
THSD4     4-0017-003chr15:
71890216-71890216
AGintronicDe novo--Trost2022 G
THSD4     5-5071-003chr15:
71896310-71896310
GCintronicDe novo--Trost2022 G
THSD4     1-0597-003chr15:
71825142-71825143
TAATintronicDe novo--Trost2022 G
THSD4     DEASD_0204_001chr15:
72037418-72037418
CTintronicDe novo--Kosmicki2017 E
Satterstrom2020 E
Trost2022 G
THSD4     AU2463301chr15:
71848556-71848556
CTintronicDe novo--Trost2022 G
THSD4     AU066403chr15:
72022870-72022870
CTintronicDe novo--Trost2022 G
Yuen2017 G
THSD4     2-0127-004chr15:
72049842-72049842
TTACCintronicDe novo--Trost2022 G
THSD4     2-0127-004chr15:
72049846-72049851
TGTAGCGCTGGTintronicDe novo--Trost2022 G
THSD4     2-0127-004chr15:
72049837-72049837
ATTGCintronicDe novo--Trost2022 G
THSD4     14160.p1chr15:
72050341-72050341
CTexonicDe novononsynonymous SNVNM_001286429
NM_024817
c.C1436T
c.C2516T
p.P479L
p.P839L
32.0-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
Turner2017 G
Wilfert2021 G
Zhou2022 GE
THSD4     2-0127-004chr15:
72049839-72049839
AATintronicDe novo--Trost2022 G
THSD4     4-0054-003chr15:
72034210-72034210
CTintronicDe novo--Trost2022 G
THSD4     MT_170.3chr15:
72042191-72042191
CAintronicDe novo--Trost2022 G
THSD4     2-1528-003chr15:
72008299-72008299
AGintronicDe novo--Trost2022 G
THSD4     mAGRE3021chr15:
72050243-72050243
CAexonicMaternalstopgainNM_001286429
NM_024817
c.C1338A
c.C2418A
p.C446X
p.C806X
37.01.0E-4Cirnigliaro2023 G
THSD4     5-5021-003chr15:
72010135-72010135
AGintronicDe novo--Trost2022 G
THSD4     mAGRE1145chr15:
72050243-72050243
CAexonicMaternalstopgainNM_001286429
NM_024817
c.C1338A
c.C2418A
p.C446X
p.C806X
37.01.0E-4Cirnigliaro2023 G
THSD4     SJD_63.3chr15:
72071362-72071364
CTTCUTR3De novo--Trost2022 G
THSD4     1-0760-003chr15:
72076034-72076034
CTdownstreamDe novo--Trost2022 G
THSD4     1-0160-004chr15:
71491916-71491916
TTGintronicDe novo--Yuen2017 G
THSD4     2-1350-003chr15:
72062984-72062984
AGintronicDe novo--Trost2022 G
THSD4     2-1408-004chr15:
71657735-71657735
GAintronicDe novo--Trost2022 G
Yuen2017 G
THSD4     2-1350-003chr15:
72062989-72062992
ATCTGTTTCAAAAAAAAAAGAintronicDe novo--Trost2022 G
THSD4     2-1338-003chr15:
71573057-71573064
TTCTGTCTTTCTintronicDe novo--Yuen2017 G
THSD4     1-0067-005chr15:
71569088-71569088
GGATGCATAintronicDe novo--Trost2022 G
Yuen2017 G
THSD4     AU2777302chr15:
72015304-72015304
CGintronicDe novo--Trost2022 G
Yuen2017 G
THSD4     Shi2013:2chr15:
71507377-71507377
CTexonicInheritednonsynonymous SNVNM_024817c.C103Tp.P35S15.659.0E-4Shi2013 G
THSD4     1-0099-003chr15:
71588100-71588100
AGintronicDe novo--Trost2022 G
Yuen2017 G
THSD4     2-1451-004chr15:
72001301-72001301
CTintronicDe novo--Trost2022 G
Yuen2017 G
THSD4     1-0067-004chr15:
71569088-71569088
GGATGCATAintronicDe novo--Trost2022 G
Yuen2017 G
THSD4     7-0001-003chr15:
71926066-71926066
CTintronicDe novo--Trost2022 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More