or
or
Exact

Results for "TBX18"

Variant Events: 37

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TBX18     5-0073-003chr6:
85812803-85812803
CTintergenicDe novo--Yuen2017 G
TBX18     AU005213chr6:
86136420-86136420
CTintergenicDe novo--Yuen2017 G
TBX18     08C74853chr6:
85470056-85470056
CGexonicDe novononsynonymous SNVNM_001080508c.G516Cp.M172I13.73-Neale2012 E
TBX18     597-04-102165chr6:
85446696-85446696
TCexonicDe novononsynonymous SNVNM_001080508c.A1531Gp.N511D9.683-Satterstrom2020 E
TBX18     2-1635-004chr6:
86106532-86106532
TCintergenicDe novo--Yuen2017 G
TBX18     1-0482-003chr6:
85518642-85518642
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
TBX18     1-0546-003chr6:
85422960-85422960
CTintergenicDe novo--Yuen2017 G
TBX18     1-0368-004chr6:
85749825-85749825
GAintergenicDe novo--Yuen2017 G
TBX18     2-0299-003chr6:
85654189-85654189
GTintergenicDe novo--Yuen2017 G
TBX18     2-1328-003chr6:
85750955-85750955
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
TBX18     7-0100-004chr6:
85608002-85608002
ACintergenicDe novo--Yuen2017 G
TBX18     1-0304-003chr6:
85832975-85832975
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
TBX18     SP0020403chr6:
85446469-85446470
GAGexonicInheritedframeshift deletionNM_001080508c.1757delTp.F586fs--Feliciano2019 E
TBX18     1-0336-004chr6:
85573572-85573575
TCCCTintergenicDe novo--Yuen2017 G
TBX18     11341.p1chr6:
85696761-85696761
ACintergenicDe novo--Turner2016 G
TBX18     2-0012-004chr6:
85548997-85548999
CAGCintergenicDe novo--Yuen2017 G
TBX18     2-1399-003chr6:
86065684-86065684
ACintergenicDe novo--Yuen2017 G
TBX18     AU075803chr6:
85550010-85550010
TCintergenicDe novo--Yuen2017 G
TBX18     AU3763305chr6:
85945174-85945174
AGintergenicDe novo--Yuen2017 G
TBX18     AU3955303chr6:
85599274-85599274
GCintergenicDe novo--Yuen2017 G
TBX18     AU3861301chr6:
85522651-85522651
ACintergenicDe novo--Yuen2017 G
TBX18     1-0632-003chr6:
85720019-85720019
CAintergenicDe novo--Yuen2017 G
TBX18     2-0323-003chr6:
85800768-85800768
CTintergenicDe novo--Yuen2017 G
TBX18     2-1374-003chr6:
85641510-85641510
CTintergenicDe novo--Yuen2017 G
TBX18     1339JS0017chr6:
85470056-85470056
CGexonicDe novononsynonymous SNVNM_001080508c.G516Cp.M172I13.73-DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
TBX18     1-0321-004chr6:
85753616-85753616
GAintergenicDe novo--Yuen2017 G
TBX18     2-1506-003chr6:
85486568-85486584
ATCTCTCTCTCTCTCTCATCTCTCTCTCTCTCintergenicDe novo--Yuen2017 G
TBX18     1-0336-003chr6:
85573572-85573575
TCCCTintergenicDe novo--Yuen2017 G
TBX18     1-0024-003chr6:
85872945-85872945
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
TBX18     2-0090-003chr6:
86036530-86036530
GAintergenicDe novo--Yuen2017 G
TBX18     5-0042-003chr6:
85917181-85917181
GAintergenicDe novo--Yuen2017 G
TBX18     AU3637301chr6:
85901576-85901576
CTintergenicDe novo--Yuen2017 G
TBX18     1-0330-004chr6:
85929784-85929784
CTintergenicDe novo--Yuen2017 G
TBX18     AU1668302chr6:
85622804-85622804
ACintergenicDe novo--Yuen2017 G
TBX18     1-0141-003chr6:
85800311-85800311
GAintergenicDe novo--Yuen2017 G
TBX18     1-0520-003chr6:
85697943-85697943
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
TBX18     5-0128-003chr6:
85737677-85737677
GAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More