or
or
Exact

Results for "SMARCC1"

Variant Events: 20

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SMARCC1     AU1795303chr3:
47813615-47813615
CTintronicDe novo--Yuen2017 G
SMARCC1     AU4079302chr3:
47818413-47818413
CTintronicDe novo--Yuen2017 G
SMARCC1     07C66440chr3:
47717077-47717077
ACexonicDe novononsynonymous SNVNM_003074c.T1727Gp.V576G17.75-Satterstrom2020 E
SMARCC1     Cukier2014:17545chr3:
47777540-47777540
AGexonicUnknownnonsynonymous SNVNM_003074c.T560Cp.I187T17.924.951E-5Cukier2014 E
SMARCC1     2-0242-005chr3:
47825685-47825685
AGintergenicDe novo--Yuen2017 G
SMARCC1     7-0188-003chr3:
47676695-47676695
CTexonicDe novosynonymous SNVNM_003074c.G2631Ap.A877A-2.475E-5Yuen2017 G
SMARCC1     2-1339-003chr3:
47718676-47718676
GAintronicDe novo--Yuen2017 G
SMARCC1     1-0381-003chr3:
47772016-47772019
AACAAAintronicDe novo--Yuen2017 G
SMARCC1     1-0469-005chr3:
47686712-47686712
TCintronicDe novo--Yuen2017 G
SMARCC1     1-0885-003chr3:
47683651-47683651
AGintronicDe novo--Yuen2017 G
SMARCC1     1-0196-005chr3:
47638620-47638620
GAintronicDe novo--Yuen2017 G
SMARCC1     2-1066-003chr3:
47826059-47826059
CCAAAAAAAAAAAAAAintergenicDe novo--Yuen2017 G
SMARCC1     2-1189-003chr3:
47763034-47763060
GCAAACAAACAAACAAACAAACAAACAGCAAACAAACAAACAAACAAACAintronicDe novo--Yuen2017 G
SMARCC1     2-1220-003chr3:
47660913-47660913
GAintronicDe novo--Yuen2016 G
Yuen2017 G
SMARCC1     AU063004chr3:
47657032-47657032
CTintronicDe novo--Yuen2017 G
SMARCC1     10C104773chr3:
47702879-47702879
TCexonicDe novononsynonymous SNVNM_003074c.A2225Gp.Q742R19.31-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Neale2012 E
Satterstrom2020 E
SMARCC1     1-0338-005chr3:
47629162-47629162
AGUTR3De novo--Yuen2017 G
SMARCC1     2-1168-003chr3:
47644687-47644687
GAintronicDe novo--Yuen2017 G
SMARCC1     AU1952305chr3:
47708665-47708665
GAintronicDe novo--Yuen2017 G
SMARCC1     5-0018-003chr3:
47706297-47706297
TCintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More