or
or
Exact

Results for "SRGAP1"

Variant Events: 15

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SRGAP1     1-0490-003chr12:
64253023-64253023
CTintronicDe novo--Yuen2017 G
SRGAP1     AU3057301chr12:
64518504-64518504
AGintronicDe novo--Yuen2017 G
SRGAP1     AU0638302chr12:
64342693-64342705
CATATATATATATCATATATATATintronicDe novo--Yuen2017 G
SRGAP1     1-0049-004chr12:
64399526-64399526
ATintronicDe novo--Yuen2017 G
SRGAP1     1721001chr12:
64456787-64456787
GAexonicDe novononsynonymous SNVNM_020762c.G892Ap.G298S33.0-Satterstrom2020 E
SRGAP1     AU056005chr12:
64482920-64482920
CTintronicDe novo--Yuen2017 G
SRGAP1     AU4033305chr12:
64350405-64350405
AGintronicDe novo--Yuen2017 G
SRGAP1     A20chr12:
64541446-64541446
GAUTR3De novo--Wu2018 G
SRGAP1     11611.p1chr12:
64491022-64491022
TGexonicDe novosynonymous SNVNM_020762c.T1680Gp.G560G-6.0E-4Satterstrom2020 E
SRGAP1     AU07204chr12:
64519821-64519821
CTexonicDe novosynonymous SNVNM_020762c.C2289Tp.S763S--DeRubeis2014 E
Kosmicki2017 E
Neale2012 E
Satterstrom2020 E
SRGAP1     1-0652-004chr12:
64571137-64571137
AGintergenicDe novo--Yuen2017 G
SRGAP1     PN400171chr12:
64521867-64521867
CTexonicUnknownnonsynonymous SNVNM_020762c.C2767Tp.R923W20.36.602E-5Leblond2019 E
SRGAP1     AU3712302chr12:
64231503-64231503
GAintergenicDe novo--Yuen2017 G
SRGAP1     1-0092-003chr12:
64481960-64481960
CTintronicDe novo--Yuen2017 G
SRGAP1     AU3154302chr12:
64435358-64435358
CTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More