or
or
Exact

Results for "PER1"

Variant Events: 12

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PER1     iHART2559chr17:
8047150-8047150
GAexonicDe novostopgainNM_002616c.C2506Tp.R836X40.0-Ruzzo2019 G
PER1     AU1829303chr17:
8047150-8047150
GAexonicDe novostopgainNM_002616c.C2506Tp.R836X40.0-Satterstrom2020 E
PER1     Li2017:16073chr17:
8051512-8051512
CTexonicUnknownnonsynonymous SNVNM_002616c.G1114Ap.D372N33.09.068E-5Li2017 T
PER1     AU1987301chr17:
8058872-8058872
AGintergenicDe novo--Yuen2017 G
PER1     Li2017:16274chr17:
8053793-8053793
CAexonicUnknownnonsynonymous SNVNM_002616c.G232Tp.G78C23.33.307E-5Li2017 T
PER1     Li2017:23124chr17:
8048072-8048072
GAexonicUnknownstopgainNM_002616c.C2458Tp.R820X41.0-Li2017 T
PER1     A32chr17:
8054532-8054532
CTintronicDe novo--Wu2018 G
PER1     1360JS0033chr17:
8044457-8044457
TCexonicDe novononsynonymous SNVNM_002616c.A3802Gp.M1268V8.072-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
PER1     G01-GEA-1-HIchr17:
8045687-8045714
GCTCAGCCCCGCCCCGAGCAGCCCCAGCGexonicDe novononframeshift deletionNM_002616c.3322_3348delp.1108_1116del-8.474E-6Satterstrom2020 E
PER1     Li2017:20644chr17:
8053364-8053364
CGexonicUnknownnonsynonymous SNVNM_002616c.G454Cp.E152Q19.53-Li2017 T
PER1     10C108663chr17:
8044457-8044457
TCexonicDe novononsynonymous SNVNM_002616c.A3802Gp.M1268V8.072-Neale2012 E
PER1     Li2017:23778chr17:
8047053-8047054
CACexonicUnknownframeshift deletionNM_002616c.2602delTp.W868fs--Li2017 T
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More