or
or
Exact

Results for "MYCBP2"

Variant Events: 36

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MYCBP2     1-0489-003chr13:
77831901-77831901
CTexonicDe novononsynonymous SNVNM_015057c.G2081Ap.C694Y29.6-Yuen2016 G
Yuen2017 G
MYCBP2     AU038203chr13:
77619451-77619451
CTUTR3De novo--Yuen2017 G
MYCBP2     7-0148-003chr13:
77903101-77903101
CTintergenicDe novo--Yuen2017 G
MYCBP2     2-1174-006chr13:
77817722-77817722
TCintronicDe novo--Yuen2017 G
MYCBP2     19273-30812chr13:
77835476-77835476
ATexonicInheritednonsynonymous SNVNM_015057c.T1682Ap.I561N19.02-Callaghan2019 G
MYCBP2     AU3905301chr13:
77963104-77963104
GCintergenicDe novo--Yuen2017 G
MYCBP2     AU3175303chr13:
78032229-78032229
AGintergenicDe novo--Yuen2017 G
MYCBP2     11194.p1chr13:
77665355-77665355
TCintronicDe novo--Turner2016 G
MYCBP2     2-0006-003chr13:
77668435-77668435
GAintronicDe novo--Yuen2017 G
MYCBP2     2-1408-004chr13:
77813166-77813166
AGintronicDe novo--Yuen2017 G
MYCBP2     1-0745-003chr13:
77948383-77948383
TCintergenicDe novo--Yuen2017 G
MYCBP2     13041.p1chr13:
77750618-77750631
TCAGTTGAAACTACTsplicingDe novosplicing--Wilfert2021 G
MYCBP2     AU3506303chr13:
77989896-77989896
CTintergenicDe novo--Yuen2017 G
MYCBP2     09C95304chr13:
77629923-77629923
TGintronicDe novo--Satterstrom2020 E
MYCBP2     1-0051-004chr13:
77932857-77932857
GAintergenicDe novo--Yuen2017 G
MYCBP2     2-0070-003chr13:
77912183-77912183
GAintergenicDe novo--Yuen2017 G
MYCBP2     AU031403chr13:
77752873-77752873
TGintronicDe novo--Yuen2017 G
MYCBP2     AU3517301chr13:
78045974-78045974
TCintergenicDe novo--Yuen2017 G
MYCBP2     1-0141-003chr13:
77754340-77754340
GAexonicDe novosynonymous SNVNM_015057c.C5055Tp.S1685S--Yuen2017 G
MYCBP2     08C76605chr13:
77807320-77807320
TCexonicDe novononsynonymous SNVNM_015057c.A2708Gp.Q903R10.26-Satterstrom2020 E
MYCBP2     2-1163-003chr13:
77907926-77907942
TTCTCTCTCTCTCTCTCTTCTCTCTCTCTCTCintergenicDe novo--Yuen2017 G
MYCBP2     2-1514-003chr13:
77932527-77932527
CAintergenicDe novo--Yuen2017 G
MYCBP2     AU3801301chr13:
78030780-78030780
CGintergenicDe novo--Yuen2017 G
MYCBP2     2-1212-003chr13:
77743311-77743311
AGintronicDe novo--Yuen2017 G
MYCBP2     1-0485-003chr13:
78079245-78079245
CAintergenicDe novo--Yuen2017 G
MYCBP2     2-0319-003chr13:
77937435-77937435
ATintergenicDe novo--Yuen2017 G
MYCBP2     AU1795302chr13:
77747837-77747837
CTintronicDe novo--Yuen2017 G
MYCBP2     612-04-102229chr13:
77779513-77779513
CTexonicDe novononsynonymous SNVNM_015057c.G3721Ap.G1241R16.59-Satterstrom2020 E
MYCBP2     2-0019-004chr13:
77646869-77646869
TCintronicDe novo--Yuen2017 G
MYCBP2     2-1521-003chr13:
77893244-77893260
CGTGTGTGTGTGTGTGTCGTGTGTGTGTGTGTintronicDe novo--Yuen2017 G
MYCBP2     AU018010chr13:
77633060-77633060
CTintronicDe novo--Yuen2017 G
MYCBP2     AU3645301chr13:
77726359-77726359
TCintronicDe novo--Yuen2017 G
MYCBP2     AU079605chr13:
78040737-78040737
GAintergenicDe novo--Yuen2017 G
MYCBP2     09C96982chr13:
77700568-77700568
AGexonicDe novononsynonymous SNVNM_015057c.T7769Cp.M2590T8.619-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Neale2012 E
Satterstrom2020 E
MYCBP2     09C81416chr13:
77760058-77760058
GCexonicDe novosynonymous SNVNM_015057c.C4392Gp.T1464T--DeRubeis2014 E
Kosmicki2017 E
MYCBP2     SP0032818chr13:
77825308-77825308
GAexonicDe novononsynonymous SNVNM_015057c.C2359Tp.R787W25.3-Feliciano2019 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More