or
or
Exact

Results for "AXDND1"

Variant Events: 15

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
AXDND1     2-1456-004chr1:
179448241-179448241
AAAGTintronicDe novo--Yuen2017 G
AXDND1     A28chr1:
179502994-179502994
AGexonicDe novononsynonymous SNVNM_144696c.A2780Gp.H927R5.1962.474E-5Wu2018 G
AXDND1     09C98975chr1:
179398643-179398643
ATintronicDe novo--Kosmicki2017 E
Satterstrom2020 E
AXDND1     2-1485-003chr1:
179448340-179448340
AGintronicDe novo--Yuen2017 G
AXDND1     AU009805chr1:
179359858-179359858
CTintronicDe novo--Yuen2017 G
AXDND1     AU071204chr1:
179384909-179384909
TGintronicDe novo--Yuen2017 G
AXDND1     2-1350-003chr1:
179448337-179448337
TCintronicDe novo--Yuen2017 G
AXDND1     1-0210-004chr1:
179375853-179375853
TCintronicDe novo--Yuen2017 G
AXDND1     2-1322-003chr1:
179373081-179373081
ACintronicDe novo--Yuen2017 G
AXDND1     06C55684Achr1:
179337957-179337957
AGexonicDe novosynonymous SNVNM_144696c.A120Gp.K40K--Neale2012 E
AXDND1     2-1306-003chr1:
179448247-179448247
TTAATAAAATAAATAAATAAAATAACACAAAAGTAACTAACTAintronicDe novo--Yuen2017 G
AXDND1     2-1526-004chr1:
179448240-179448240
AAACGAACAAACAGATintronicDe novo--Yuen2017 G
AXDND1     2-0289-003chr1:
179448356-179448356
ACintronicDe novo--Yuen2017 G
AXDND1     2-1506-003chr1:
179343494-179343494
GAintronicDe novo--Yuen2017 G
AXDND1     AU3371302chr1:
179488266-179488266
CTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More