or
or
Exact

Results for "HDAC9"

Variant Events: 73

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
HDAC9     3-0661-000chr7:
18567126-18567126
GAintronicDe novo--Yuen2017 G
HDAC9     2-1313-003chr7:
19138514-19138514
GAintergenicDe novo--Yuen2017 G
HDAC9     2-1148-004chr7:
19038557-19038557
CTintergenicDe novo--Yuen2017 G
HDAC9     AU066404chr7:
18224874-18224874
CGintronicDe novo--Yuen2017 G
HDAC9     1-0971-003chr7:
18524029-18524029
AGintronicDe novo--Yuen2017 G
HDAC9     3-0169-000chr7:
19063396-19063396
CGintergenicDe novo--Yuen2016 G
HDAC9     1-0019-004chr7:
19031087-19031087
TCintronicDe novo--Yuen2017 G
HDAC9     1-0541-003chr7:
18751961-18751961
GAintronicDe novo--Yuen2017 G
HDAC9     13076.p1chr7:
18624949-18624949
CTexonicDe novononsynonymous SNVNM_058176
NM_178425
NM_001204145
NM_001204146
NM_014707
NM_178423
NM_001204144
c.C68T
c.C68T
c.C68T
c.C68T
c.C68T
c.C68T
c.C194T
p.P23L
p.P23L
p.P23L
p.P23L
p.P23L
p.P23L
p.P65L
35.0-Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Turner2017 G
Wilfert2021 G
HDAC9     1-0049-004chr7:
18196507-18196507
TGintronicDe novo--Yuen2017 G
HDAC9     1-0389-004chr7:
19071204-19071206
TTCTintergenicDe novo--Yuen2017 G
HDAC9     SSC06722chr7:
18624949-18624949
CTexonicDe novononsynonymous SNVNM_058176
NM_178425
NM_001204145
NM_001204146
NM_014707
NM_178423
NM_001204144
c.C68T
c.C68T
c.C68T
c.C68T
c.C68T
c.C68T
c.C194T
p.P23L
p.P23L
p.P23L
p.P23L
p.P23L
p.P23L
p.P65L
35.0-Lim2017 E
HDAC9     1-0373-003chr7:
18273103-18273103
CTintronicDe novo--Yuen2017 G
HDAC9     M13360chr7:
18668997-18668997
GAexonicUnknownnonsynonymous SNVNM_001204148
NM_058176
NM_178425
NM_014707
NM_178423
c.G596A
c.G680A
c.G689A
c.G680A
c.G680A
p.R199Q
p.R227Q
p.R230Q
p.R227Q
p.R227Q
20.9-Stessman2017 T
HDAC9     1-0914-003chr7:
18975049-18975049
CAintronicDe novo--Yuen2017 G
HDAC9     AU2108302chr7:
18628890-18628890
CGintronicDe novo--Yuen2017 G
HDAC9     AU3905301chr7:
18304955-18304955
CTintronicDe novo--Yuen2017 G
HDAC9     AU2019302chr7:
18236561-18236561
AGintronicDe novo--Yuen2017 G
HDAC9     2-0210-005chr7:
18484114-18484114
AGintronicDe novo--Yuen2017 G
HDAC9     AU1687302chr7:
18774220-18774220
TCintronicDe novo--Yuen2017 G
HDAC9     AU4483301chr7:
19015498-19015498
ACexonicDe novononsynonymous SNVNM_178425
NM_178423
c.A3092C
c.A3083C
p.Q1031P
p.Q1028P
14.39-Yuen2017 G
HDAC9     7-0179-003chr7:
18208193-18208208
CTGTGTGTGTGTGTGTCTGTGTGTGTGTGTintronicDe novo--Yuen2017 G
HDAC9     AU3052301chr7:
18930607-18930607
CTintronicDe novo--Yuen2017 G
HDAC9     1-0273-004chr7:
18148600-18148600
CTintronicDe novo--Yuen2017 G
HDAC9     2-1509-003chr7:
18822772-18822772
GAintronicDe novo--Yuen2017 G
HDAC9     AU076808chr7:
18939668-18939668
CGintronicDe novo--Yuen2017 G
HDAC9     2-1506-003chr7:
18547114-18547130
CTATTATTATTATTATTCTATTATTATTATTintronicDe novo--Yuen2017 G
HDAC9     F9985-1chr7:
18833005-18833005
CGexonicDe novononsynonymous SNVNM_058176
NM_178425
NM_178423
c.C2243G
c.C2252G
c.C2243G
p.S748C
p.S751C
p.S748C
16.15-Satterstrom2020 E
HDAC9     1-0571-003chr7:
18941291-18941291
GAintronicDe novo--Yuen2017 G
HDAC9     AU2433302chr7:
19090896-19090896
CTintergenicDe novo--Yuen2017 G
HDAC9     1-0497-003chr7:
18998167-18998167
AGintronicDe novo--Yuen2017 G
HDAC9     5-0095-003chr7:
18737158-18737165
TCTTCCTTTCTTintronicDe novo--Yuen2017 G
HDAC9     2-1506-003chr7:
18740516-18740516
GAintronicDe novo--Yuen2017 G
HDAC9     2-1315-003chr7:
18146563-18146563
AGintronicDe novo--Yuen2016 G
Yuen2017 G
HDAC9     AU4444304chr7:
19073943-19073943
GTintergenicDe novo--Yuen2017 G
HDAC9     1-0531-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
HDAC9     AU081104chr7:
18975476-18975476
CTexonicUnknownnonsynonymous SNVNM_058176
NM_178425
NM_178423
c.C2839T
c.C2848T
c.C2839T
p.R947C
p.R950C
p.R947C
26.68.283E-6Stessman2017 T
HDAC9     1-0479-006chr7:
18456030-18456030
AGintronicDe novo--Yuen2017 G
HDAC9     3-0392-000chr7:
18744438-18744438
AGintronicDe novo--Yuen2016 G
HDAC9     1-0483-003chr7:
18191687-18191687
ACintronicDe novo--Yuen2016 G
Yuen2017 G
HDAC9     1-0354-006chr7:
18670228-18670228
AGintronicDe novo--Yuen2017 G
HDAC9     74-0352chr7:
18212149-18212149
CTintronicDe novo--Michaelson2012 G
HDAC9     2-0289-004chr7:
18244823-18244823
CGintronicDe novo--Yuen2017 G
HDAC9     3-0469-000chr7:
18804407-18804407
GAintronicDe novo--Yuen2017 G
HDAC9     AU4243302chr7:
18581683-18581683
TAintronicDe novo--Yuen2017 G
HDAC9     217-14283-4060chr7:
18669051-18669052
GGGexonicUnknownframeshift deletionNM_001204148
NM_058176
NM_178425
NM_014707
NM_178423
c.651delG
c.735delG
c.744delG
c.735delG
c.735delG
p.R217fs
p.R245fs
p.R248fs
p.R245fs
p.R245fs
--Stessman2017 T
HDAC9     1-0032-003chr7:
18758881-18758881
AACTTTATGGintronicDe novo--Yuen2017 G
HDAC9     1-0065-005chr7:
18319425-18319425
AAACTAGTTTCintronicDe novo--Yuen2017 G
HDAC9     1-0381-003chr7:
18305983-18305983
TCintronicDe novo--Yuen2017 G
HDAC9     AU3911302chr7:
19120473-19120473
GTintergenicDe novo--Yuen2017 G
HDAC9     2-0307-004chr7:
18740912-18740912
AGintronicDe novo--Yuen2017 G
HDAC9     2-1246-003chr7:
18736366-18736366
CGintronicDe novo--Yuen2017 G
HDAC9     2-1283-004chr7:
18610751-18610751
CTintronicDe novo--Yuen2017 G
HDAC9     AU3645301chr7:
18588248-18588248
AGintronicDe novo--Yuen2017 G
HDAC9     1-0455-003chr7:
18722112-18722112
TGintronicDe novo--Yuen2017 G
HDAC9     AU4007302chr7:
18453591-18453591
GAintronicDe novo--Yuen2017 G
HDAC9     AU1742302chr7:
18786516-18786516
GAintronicDe novo--Yuen2017 G
HDAC9     2-1362-003chr7:
18579602-18579602
CTintronicDe novo--Yuen2017 G
HDAC9     AU072504chr7:
19131479-19131479
TCintergenicDe novo--Yuen2017 G
HDAC9     AU054303chr7:
18826789-18826789
TCintronicDe novo--Yuen2017 G
HDAC9     AU1987304chr7:
18153977-18153977
ACintronicDe novo--Yuen2017 G
HDAC9     1-0606-003chr7:
19007243-19007243
CAintronicDe novo--Yuen2017 G
HDAC9     1-0401-003chr7:
19102157-19102158
TCTintergenicDe novo--Yuen2017 G
HDAC9     2-1735-003chr7:
19089196-19089196
CAintergenicDe novo--Yuen2017 G
HDAC9     2-1266-003chr7:
18885284-18885284
AGintronicDe novo--Yuen2016 G
Yuen2017 G
HDAC9     5-0018-003chr7:
18187284-18187284
TTTTTAAGCintronicDe novo--Yuen2017 G
HDAC9     5-0077-004chr7:
18710595-18710595
TCintronicDe novo--Yuen2017 G
HDAC9     2-1085-003chr7:
18408401-18408401
CAintronicDe novo--Yuen2017 G
HDAC9     1-0141-003chr7:
18385993-18385993
AGintronicDe novo--Yuen2017 G
HDAC9     2-1318-004chr7:
18242224-18242226
GTTGintronicDe novo--Yuen2017 G
HDAC9     AU1687303chr7:
18774220-18774220
TCintronicDe novo--Yuen2017 G
HDAC9     2-1336-003chr7:
18535985-18535985
GCintronicDe novo--Yuen2017 G
HDAC9     2-1283-003chr7:
18610751-18610751
CTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More