or
or
Exact

Results for "BSN"

Variant Events: 22

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
BSN     1-0556-003chr3:
49621297-49621323
GATTTATTTATTTATTTATTTATTTATGATTTATTTATTTATTTATTTATintronicDe novo--Yuen2017 G
BSN     SMHC00891s000chr3:
49692855-49692855
CTexonicDe novononsynonymous SNVNM_003458c.C5866Tp.R1956W9.7643.681E-5Yuan2023 E
BSN     2-1429-004chr3:
49708296-49708296
CGUTR3De novo--Trost2022 G
Yuen2017 G
BSN     AU1988302chr3:
49689290-49689290
GAexonicDe novosynonymous SNVNM_003458c.G2301Ap.T767T--Trost2022 G
Yuen2017 G
Zhou2022 GE
BSN     SP0027448chr3:
49691246-49691246
TCexonicDe novosynonymous SNVNM_003458c.T4257Cp.Y1419Y--Feliciano2019 E
Fu2022 E
Trost2022 G
Zhou2022 GE
BSN     AU1987304chr3:
49682579-49682579
AGintronicDe novo--Trost2022 G
Yuen2017 G
BSN     SP0017096chr3:
49692908-49692908
AGexonicDe novosynonymous SNVNM_003458c.A5919Gp.P1973P--Fu2022 E
Trost2022 G
Zhou2022 GE
BSN     SP0246511chr3:
49691827-49691827
CTexonicDe novononsynonymous SNVNM_003458c.C4838Tp.P1613L1.085-Trost2022 G
BSN     SP0101498chr3:
49699714-49699714
CTexonicDe novononsynonymous SNVNM_003458c.C10436Tp.A3479V6.1459.132E-5Fu2022 E
Trost2022 G
Zhou2022 GE
BSN     SP0179610chr3:
49693251-49693251
GGCexonicDe novoframeshift insertionNM_003458c.6263dupCp.A2088fs--Trost2022 G
BSN     5317chr3:
49701070-49701070
ACexonicDe novononsynonymous SNVNM_003458c.A11479Cp.T3827P3.344-Fu2022 E
BSN     AU2320301chr3:
49684353-49684353
GAintronicDe novo--Trost2022 G
BSN     1-0971-003chr3:
49674417-49674417
CGintronicDe novo--Trost2022 G
Yuen2017 G
BSN     2-1759-003chr3:
49685170-49685170
GTintronicDe novo--Trost2022 G
BSN     7-0408-003chr3:
49632392-49632392
CTintronicDe novo--Trost2022 G
BSN     SP0165509chr3:
49662377-49662377
TCintronicDe novo--Trost2022 G
BSN     SP0128755chr3:
49694793-49694793
CTexonicDe novononsynonymous SNVNM_003458c.C7804Tp.R2602C12.862.505E-5Fu2022 E
Trost2022 G
Zhou2022 GE
BSN     EGAN00001101026chr3:
49700840-49700840
GAexonicDe novononsynonymous SNVNM_003458c.G11249Ap.R3750Q14.597.539E-5Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
BSN     MT_45.3chr3:
49698258-49698258
CTexonicDe novononsynonymous SNVNM_003458c.C8980Tp.R2994W10.148.309E-6Trost2022 G
Zhou2022 GE
BSN     DEASD_0445_001chr3:
49694871-49694871
CTexonicDe novononsynonymous SNVNM_003458c.C7882Tp.R2628C11.58.392E-6DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
BSN     2-1297-003chr3:
49630200-49630200
AGintronicDe novo--Yuen2017 G
BSN     1000128651330706-Cchr3:
49699893-49699893
GCexonicDe novononsynonymous SNVNM_003458c.G10615Cp.D3539H13.95-Fu2022 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More