or
or
Exact

Results for "CDK13"

Variant Events: 29

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CDK13     1-0394-003chr7:
40156380-40156397
GAGGCATAGTGGCAGGCAGAGGCAintergenicDe novo--Yuen2017 G
CDK13     AGRE_02C11941chr7:
40038997-40038997
GTexonicUnknownnonsynonymous SNVNM_003718
NM_031267
c.G2080T
c.G2080T
p.D694Y
p.D694Y
25.81.652E-5Wang2020 T
CDK13     G01-GEA-259-HIchr7:
40102495-40102495
TCexonicDe novononsynonymous SNVNM_003718
NM_031267
c.T2671C
c.T2671C
p.Y891H
p.Y891H
23.6-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
CDK13     SSC11731chr7:
40085456-40085456
ATexonicnonsynonymous SNVNM_003718
NM_031267
c.A2375T
c.A2375T
p.E792V
p.E792V
21.4-Antaki2022 GE
CDK13     iHART1748chr7:
40132548-40132548
GTexonicPaternalstopgainNM_003718c.G3400Tp.G1134X47.0-Ruzzo2019 G
CDK13     AGRE_05C41376chr7:
40102493-40102493
GAexonicUnknownnonsynonymous SNVNM_003718
NM_031267
c.G2669A
c.G2669A
p.R890Q
p.R890Q
25.6-Wang2020 T
CDK13     ACGC_GX0379.p1chr7:
40087454-40087454
CTexonicPaternalstopgainNM_003718
NM_031267
c.C2578T
c.C2578T
p.R860X
p.R860X
42.08.244E-6Wang2020 T
CDK13     AGRE_05C41362chr7:
40102493-40102493
GAexonicUnknownnonsynonymous SNVNM_003718
NM_031267
c.G2669A
c.G2669A
p.R890Q
p.R890Q
25.6-Wang2020 T
CDK13     5-0055-003chr7:
40116146-40116146
GAintronicDe novo--Trost2022 G
Yuen2017 G
CDK13     SP0113642chr7:
40118416-40118416
CTexonicDe novostopgainNM_003718
NM_031267
c.C2995T
c.C2995T
p.R999X
p.R999X
42.0-Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
CDK13     1-0572-003 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
CDK13     2-1427-003chr7:
40064092-40064092
CTintronicDe novo--Trost2022 G
Yuen2017 G
CDK13     SP0062243chr7:
39989249-39989249
TCupstreamDe novo--Fu2022 E
Trost2022 G
CDK13     SMHC01750s000chr7:
40102426-40102426
CTexonicDe novononsynonymous SNVNM_003718
NM_031267
c.C2602T
c.C2602T
p.R868W
p.R868W
33.0-Yuan2023 E
CDK13     14308.p1chr7:
40085456-40085456
ATexonicDe novo, Mosaic Mat., Unknownnonsynonymous SNVNM_003718
NM_031267
c.A2375T
c.A2375T
p.E792V
p.E792V
21.4-Dou2017 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Wang2020 T
Zhou2022 GE
CDK13     MSSNG00133-003chr7:
40094218-40094218
TCintronicDe novo--Trost2022 G
CDK13     MSSNG00040-004chr7:
40100274-40100274
TAintronicDe novo--Trost2022 G
CDK13     mAGRE1748chr7:
40132548-40132548
GTexonicPaternalstopgainNM_003718c.G3400Tp.G1134X47.0-Cirnigliaro2023 G
CDK13     3-0143-000chr7:
40088813-40088813
AGintronicDe novo--Trost2022 G
CDK13     MSSNG00438-003chr7:
40089114-40089114
TCintronicDe novo--Trost2022 G
CDK13     SP0197502chr7:
39991090-39991090
AGexonicDe novononsynonymous SNVNM_003718
NM_031267
c.A850G
c.A850G
p.K284E
p.K284E
14.88-Trost2022 G
CDK13     1-0842-003chr7:
40020125-40020125
TTGintronicDe novo--Trost2022 G
CDK13     13309.p1chr7:
40085808-40085808
CGintronicDe novo--Werling2018 G
CDK13     SF0113642.p1chr7:
40118416-40118416
CTexonicstopgainNM_003718
NM_031267
c.C2995T
c.C2995T
p.R999X
p.R999X
42.0-Wang2020 T
CDK13     110405chr7:
40085587-40085587
AGexonicDe novononsynonymous SNVNM_003718
NM_031267
c.A2506G
c.A2506G
p.R836G
p.R836G
16.38-Fu2022 E
CDK13     3-0409-000chr7:
40108466-40108467
AGAintronicDe novo--Trost2022 G
CDK13     14308_p1chr7:
40085456-40085456
ATexonicDe novononsynonymous SNVNM_003718
NM_031267
c.A2375T
c.A2375T
p.E792V
p.E792V
21.4-Fu2022 E
CDK13     MSSNG00392-003chr7:
40169298-40169298
GAintergenicDe novo--Trost2022 G
CDK13     2-1343-003chr7:
40141807-40141807
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More