or
or
Exact

Results for "ZNF138"

Variant Events: 6

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ZNF138     1-0514-003chr7:
64259733-64259733
GAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
ZNF138     80001101975chr7:
64292270-64292354
ATACTGGAGAAAAACCCTACAAATGTGAAGTATGTGGAAAAGCCTTTCACCAATCCTCAATCCTTACTAAACATAAGATAATTCGAexonicDe novononframeshift deletionNM_001271649
NM_006524
NM_001271638
NM_001271639
c.210_293del
c.573_656del
c.555_638del
c.651_734del
p.70_98del
p.191_219del
p.185_213del
p.217_245del
--Fu2022 E
ZNF138     7-0351-003chr7:
64268293-64268293
TCintronicDe novo--Trost2022 G
ZNF138     SMHC01197s000chr7:
64275368-64275368
CTexonicDe novononsynonymous SNVNM_001160183
NM_001271637
NM_001271639
NM_001271640
NM_006524
NM_001271638
c.C76T
c.C76T
c.C76T
c.C76T
c.C76T
c.C58T
p.R26W
p.R26W
p.R26W
p.R26W
p.R26W
p.R20W
5.6354.124E-5Yuan2023 E
ZNF138     AU3906301chr7:
64343086-64343086
GTintergenicDe novo--Yuen2017 G
ZNF138     1-0756-004chr7:
64285760-64285760
CTintronicDe novo--Trost2022 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More