or
or
Exact

Results for "WRN"

Variant Events: 54

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
WRN     12650.p1chr8:
31008747-31008747
AGintronicMosaic--Dou2017 E
WRN     2-1283-003chr8:
30919836-30919836
CGintronicDe novo--Trost2022 G
Yuen2017 G
WRN     2-1005-003chr8:
31449707-31449707
CTintergenicDe novo--Yuen2017 G
WRN     2-0297-004chr8:
30916443-30916443
GAintronicDe novo--Trost2022 G
Yuen2017 G
WRN     2-0110-003chr8:
31089654-31089654
GCintergenicDe novo--Yuen2017 G
WRN     AU3857301chr8:
31201668-31201668
CTintergenicDe novo--Yuen2017 G
WRN     TRE_2508chr8:
31024610-31024610
TCexonicDe novononsynonymous SNVNM_000553c.T4055Cp.I1352T15.88-Fu2022 E
WRN     1-0052-004chr8:
31337816-31337816
TTAGAGintergenicDe novo--Yuen2017 G
WRN     A24chr8:
31143250-31143250
CGintergenicDe novo--Wu2018 G
WRN     AU027506chr8:
31300460-31300460
TCintergenicDe novo--Yuen2017 G
WRN     AU4235302chr8:
31368276-31368279
ATTTATTintergenicDe novo--Yuen2017 G
WRN     EGAN00001101341chr8:
30999109-30999109
CAexonicDe novononsynonymous SNVNM_000553c.C3131Ap.T1044K16.91-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
WRN     AU059903chr8:
31218328-31218328
GAintergenicDe novo--Yuen2017 G
WRN     SP0006076chr8:
30973937-30973937
AGexonicDe novononsynonymous SNVNM_000553c.A2341Gp.T781A12.05-Fu2022 E
Trost2022 G
Zhou2022 GE
WRN     2-1725-003chr8:
31078683-31078683
ACintergenicDe novo--Yuen2017 G
WRN     2-1506-003chr8:
31336632-31336632
ACintergenicDe novo--Yuen2017 G
WRN     1-0257-003chr8:
31414808-31414808
AGintergenicDe novo--Yuen2017 G
WRN     AU3881302chr8:
31046657-31046657
GTintergenicDe novo--Yuen2017 G
WRN     AU005213chr8:
30893748-30893748
AGintronicDe novo--Trost2022 G
Yuen2017 G
WRN     1-0455-004chr8:
31444187-31444189
CTTCintergenicDe novo--Yuen2017 G
WRN     AU4089301chr8:
30946406-30946407
ACAexonicPaternalframeshift deletionNM_000553c.1578delCp.D526fs-3.346E-5Cirnigliaro2023 G
WRN     mAGRE5736chr8:
30938648-30938648
CTexonicPaternalstopgainNM_000553c.C1105Tp.R369X37.02.0E-4Cirnigliaro2023 G
WRN     mAGRE3014chr8:
30938648-30938648
CTexonicPaternalstopgainNM_000553c.C1105Tp.R369X37.02.0E-4Cirnigliaro2023 G
WRN     AU4237301chr8:
31057455-31057455
TCintergenicDe novo--Yuen2017 G
WRN     mAGRE3013chr8:
30938648-30938648
CTexonicPaternalstopgainNM_000553c.C1105Tp.R369X37.02.0E-4Cirnigliaro2023 G
WRN     mAGRE3012chr8:
30938648-30938648
CTexonicPaternalstopgainNM_000553c.C1105Tp.R369X37.02.0E-4Cirnigliaro2023 G
WRN     mAGRE5698chr8:
30924567-30924568
TGTexonicMaternalstopgainNM_000553c.524delGp.W175X-8.241E-6Cirnigliaro2023 G
WRN     1-0994-003chr8:
31161825-31161831
ATATTATATATintergenicDe novo--Yuen2017 G
WRN     7-0166-003chr8:
31086333-31086333
CTintergenicDe novo--Yuen2017 G
WRN     AU3852301chr8:
31315315-31315315
GAintergenicDe novo--Yuen2017 G
WRN     mAGRE1317chr8:
31004567-31004567
AGsplicingMaternalsplicing18.558.808E-6Cirnigliaro2023 G
WRN     mAGRE2357chr8:
30969236-30969236
CTexonicMaternalstopgainNM_000553c.C2194Tp.R732X42.02.473E-5Cirnigliaro2023 G
WRN     2-1283-004chr8:
30919836-30919836
CGintronicDe novo--Yuen2017 G
WRN     mAGRE2355chr8:
30969236-30969236
CTexonicMaternalstopgainNM_000553c.C2194Tp.R732X42.02.473E-5Cirnigliaro2023 G
WRN     iHART2357chr8:
30969236-30969236
CTexonicMaternalstopgainNM_000553c.C2194Tp.R732X42.02.473E-5Ruzzo2019 G
WRN     iHART2355chr8:
30969236-30969236
CTexonicMaternalstopgainNM_000553c.C2194Tp.R732X42.02.473E-5Ruzzo2019 G
WRN     AU3955303chr8:
31377404-31377404
CGintergenicDe novo--Yuen2017 G
WRN     iHART1317chr8:
31004567-31004567
AGsplicingMaternalsplicing18.558.808E-6Ruzzo2019 G
WRN     AU4145303chr8:
31067601-31067601
CGintergenicDe novo--Yuen2017 G
WRN     AU046703chr8:
31062014-31062014
GAintergenicDe novo--Yuen2017 G
WRN     SP0036741chr8:
31030593-31030593
CTexonicDe novononsynonymous SNVNM_000553c.C4274Tp.T1425M9.3823.333E-5Feliciano2019 E
Fu2022 E
Trost2022 G
Zhou2022 GE
WRN     REACH000293chr8:
30950138-30950138
AGintronicDe novo--Trost2022 G
WRN     2-1562-003chr8:
31079852-31079852
GAintergenicDe novo--Yuen2017 G
WRN     SP0013003chr8:
30954265-30954265
CAintronicDe novo--Trost2022 G
WRN     MT_170.3chr8:
30906352-30906352
AGintronicDe novo--Trost2022 G
WRN     2-1266-003chr8:
31318573-31318573
GTintergenicDe novo--Yuen2016 G
Yuen2017 G
WRN     1-0172-005chr8:
30909437-30909437
GAintronicDe novo--Trost2022 G
WRN     SMHC01910s000chr8:
30969308-30969308
ACexonicDe novononsynonymous SNVNM_000553c.A2266Cp.K756Q12.52-Yuan2023 E
WRN     5-5022-003chr8:
30895574-30895574
TGintronicDe novo--Trost2022 G
WRN     14061.p1chr8:
30942620-30942649
GCAGAAAAGAGGATATGAAGTCAATTATATGintronicDe novo--Iossifov2014 E
Kosmicki2017 E
WRN     2-0006-003chr8:
31494719-31494719
ACintergenicDe novo--Yuen2017 G
WRN     MSSNG00441-003chr8:
31033719-31033719
GAintergenicDe novo--Trost2022 G
WRN     2-1692-003chr8:
30993399-30993399
GAintronicDe novo--Trost2022 G
WRN     3-0380-002chr8:
30995529-30995529
GAintronicDe novo--Trost2022 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More