or
or
Exact

Results for "ABCG8"

Variant Events: 29

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ABCG8     MT_170.3chr2:
44096394-44096394
CGintronicDe novo--Trost2022 G
ABCG8     3-0515-001chr2:
44080102-44080111
AACTCCCAGAGGCCGGGCGCintronicDe novo--Trost2022 G
ABCG8     2-1411-003chr2:
44098453-44098453
AGintronicDe novo--Trost2022 G
ABCG8     MT_170.3chr2:
44096524-44096524
AGintronicDe novo--Trost2022 G
ABCG8     5-0050-003chr2:
44076722-44076736
TCTCCCCAGATGCCATintronicDe novo--Trost2022 G
ABCG8     2-1428-003chr2:
44089515-44089515
TGintronicDe novo--Yuen2017 G
ABCG8     7-0464-003chr2:
44069712-44069712
CGintronicDe novo--Trost2022 G
ABCG8     MC-035-3chr2:
44099244-44099244
CTexonicMaternalnonsynonymous SNVNM_022437c.C1094Tp.T365M11.355.0E-4Tuncay2023 G
ABCG8     2-1411-003chr2:
44098481-44098481
CTintronicDe novo--Trost2022 G
ABCG8     2-1411-003chr2:
44098465-44098465
CAintronicDe novo--Trost2022 G
ABCG8     MT_183.4chr2:
44098559-44098559
GCintronicDe novo--Trost2022 G
ABCG8     2-1411-003chr2:
44098485-44098485
ACintronicDe novo--Trost2022 G
ABCG8     SP0108575chr2:
44079647-44079647
GCintronicDe novo--Fu2022 E
Trost2022 G
ABCG8     MC-035-3chr2:
44073312-44073312
GTexonicPaternalnonsynonymous SNVNM_022437c.G184Tp.V62F12.261.648E-5Tuncay2023 G
ABCG8     2-0197-004chr2:
44083510-44083510
AACTintronicDe novo--Yuen2017 G
ABCG8     F9958-1chr2:
44079890-44079890
GCexonicDe novononsynonymous SNVNM_022437c.G847Cp.V283L14.27-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
ABCG8     mAGRE1321chr2:
44079854-44079854
CTexonicMaternalstopgainNM_022437c.C811Tp.Q271X38.0-Cirnigliaro2023 G
ABCG8     mAGRE1740chr2:
44079575-44079575
GGGGGTGAGCGCAexonicMaternalframeshift insertionNM_022437c.644_645insGGGTGAGCGCAp.G215fs--Cirnigliaro2023 G
ABCG8     mAGRE1738chr2:
44079575-44079575
GGGGGTGAGCGCAexonicMaternalframeshift insertionNM_022437c.644_645insGGGTGAGCGCAp.G215fs--Cirnigliaro2023 G
ABCG8     SMHC01703s000chr2:
44102301-44102301
CTexonicDe novononsynonymous SNVNM_022437c.C1505Tp.P502L19.231.649E-5Yuan2023 E
ABCG8     5-0050-004chr2:
44076722-44076736
TCTCCCCAGATGCCATintronicDe novo--Trost2022 G
Yuen2017 G
ABCG8     mAGRE2298chr2:
44101609-44101614
ATTTCTAexonicMaternalframeshift deletionNM_022437c.1476_1480delp.Y492fs--Cirnigliaro2023 G
ABCG8     mAGRE4432chr2:
44100948-44100948
CTexonicMaternalstopgainNM_022437c.C1234Tp.R412X37.01.0E-4Cirnigliaro2023 G
ABCG8     mAGRE1322chr2:
44079854-44079854
CTexonicMaternalstopgainNM_022437c.C811Tp.Q271X38.0-Cirnigliaro2023 G
ABCG8     iHART1322chr2:
44079854-44079854
CTexonicMaternalstopgainNM_022437c.C811Tp.Q271X38.0-Ruzzo2019 G
ABCG8     iHART1321chr2:
44079854-44079854
CTexonicMaternalstopgainNM_022437c.C811Tp.Q271X38.0-Ruzzo2019 G
ABCG8     iHART2298chr2:
44101609-44101614
ATTTCTAexonicMaternalframeshift deletionNM_022437c.1476_1480delp.Y492fs--Ruzzo2019 G
ABCG8     iHART1738chr2:
44079575-44079575
GGGGGTGAGCGCAexonicMaternalframeshift insertionNM_022437c.644_645insGGGTGAGCGCAp.G215fs--Ruzzo2019 G
ABCG8     iHART1740chr2:
44079575-44079575
GGGGGTGAGCGCAexonicMaternalframeshift insertionNM_022437c.644_645insGGGTGAGCGCAp.G215fs--Ruzzo2019 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More