or
or
Exact

Results for "PROX1"

Variant Events: 17

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PROX1     SMHC01816s000chr1:
214170357-214170357
AGexonicDe novononsynonymous SNVNM_001270616
NM_002763
c.A479G
c.A479G
p.E160G
p.E160G
17.45-Yuan2023 E
PROX1     1-0196-005chr1:
214316504-214316504
GAintergenicDe novo--Yuen2017 G
PROX1     1-0579-003chr1:
214340947-214340963
GCTCTCTCTCTCTCTCTGCTCTCTCTCTCTCTintergenicDe novo--Yuen2017 G
PROX1     1-0121-003chr1:
214287421-214287421
GAintergenicDe novo--Yuen2017 G
PROX1     2-1444-003chr1:
214191036-214191036
CGintronicDe novo--Trost2022 G
Yuen2017 G
PROX1     2-0244-003chr1:
214282405-214282405
TTTATAAintergenicDe novo--Yuen2017 G
PROX1     AU3721302chr1:
214169335-214169335
TAintronicDe novo--Trost2022 G
PROX1     AU3721302 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
PROX1     AU4056301chr1:
214196691-214196692
TATAAintronicDe novo--Yuen2017 G
PROX1     2-1267-003chr1:
214198891-214198891
CTintronicDe novo--Trost2022 G
Yuen2017 G
PROX1     1-0261-004chr1:
214168499-214168499
GAintronicDe novo--Trost2022 G
Yuen2017 G
PROX1     AU3605303chr1:
214166874-214166874
CTintronicDe novo--Trost2022 G
Yuen2017 G
PROX1     1-0354-003chr1:
214266830-214266830
AGintergenicDe novo--Yuen2017 G
PROX1     1-0874-003chr1:
214315914-214315914
TCintergenicDe novo--Yuen2017 G
PROX1     AU015903chr1:
214322356-214322360
AGGGGAGGGintergenicDe novo--Yuen2017 G
PROX1     AU3713301chr1:
214227869-214227869
GAintergenicDe novo--Yuen2017 G
PROX1     7-0383-003chr1:
214161833-214161836
ATCTAintronicDe novo--Trost2022 G
Zhou2022 GE
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More