or
or
Exact

Results for "MAP2K6"

Variant Events: 28

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MAP2K6     1-1018-003chr17:
67517966-67517966
ACintronicDe novo--Trost2022 G
MAP2K6     MT_69.4chr17:
67529730-67529730
TCintronicDe novo--Trost2022 G
MAP2K6     5-5180-003chr17:
67453574-67453574
AGintronicDe novo--Trost2022 G
MAP2K6     10-0008-003chr17:
67460381-67460381
AAAAGintronicDe novo--Trost2022 G
MAP2K6     2-1429-004chr17:
67413049-67413049
AGintronicDe novo--Trost2022 G
Yuen2017 G
MAP2K6     AU3847302chr17:
67499400-67499400
CTintronicDe novo--Trost2022 G
Yuen2017 G
MAP2K6     1-0273-004chr17:
67554585-67554585
CAintergenicDe novo--Yuen2017 G
MAP2K6     AU3586303chr17:
67467455-67467455
AGintronicDe novo--Trost2022 G
Yuen2017 G
MAP2K6     2-1411-003chr17:
67420226-67420226
TCintronicDe novo--Yuen2016 G
MAP2K6     AU1223303chr17:
67487911-67487911
TCintronicDe novo--Trost2022 G
Yuen2017 G
MAP2K6     13515.p1chr17:
67475921-67475921
CTintronicDe novo--Turner2016 G
MAP2K6     SP0058481chr17:
67513733-67513733
CAexonicDe novononsynonymous SNVNM_002758c.C225Ap.S75R19.6-Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
MAP2K6     5-0042-003chr17:
67484027-67484027
GAintronicDe novo--Trost2022 G
Yuen2017 G
MAP2K6     1-0367-003chr17:
67559902-67559919
GTCTCTCTCTCTCTCTCTGTCTCTCTCTCTCTCTintergenicDe novo--Yuen2017 G
MAP2K6     1-0224-004chr17:
67532482-67532486
AGGTTAintronicDe novo--Trost2022 G
Yuen2017 G
MAP2K6     08C77439chr17:
67513027-67513027
ATexonicDe novononsynonymous SNVNM_002758c.A115Tp.I39F21.7-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
MAP2K6     08C77439chr17:
67513031-67513031
CTexonicDe novononsynonymous SNVNM_002758c.C119Tp.S40F16.79-DeRubeis2014 E
Kosmicki2017 E
Zhou2022 GE
MAP2K6     1-0473-003chr17:
67488998-67489000
GATGintronicDe novo--Trost2022 G
Yuen2017 G
MAP2K6     5-0040-003chr17:
67460381-67460381
AAAAGintronicDe novo--Trost2022 G
Yuen2017 G
MAP2K6     2-1438-003chr17:
67587173-67587173
CGintergenicDe novo--Yuen2016 G
Yuen2017 G
MAP2K6     1-0336-003chr17:
67512152-67512152
GAintronicDe novo--Trost2022 G
Yuen2017 G
MAP2K6     AU2793303chr17:
67428804-67428804
GAintronicDe novo--Yuen2017 G
MAP2K6     SMHC01676s000chr17:
67519768-67519768
AGexonicDe novononsynonymous SNVNM_002758c.A649Gp.K217E27.9-Yuan2023 E
MAP2K6     7-0353-003chr17:
67442909-67442909
CTintronicDe novo--Trost2022 G
MAP2K6     1-0677-004Achr17:
67450154-67450154
AGintronicDe novo--Trost2022 G
MAP2K6     MSSNG00004-004chr17:
67415036-67415036
GAintronicDe novo--Trost2022 G
MAP2K6     2-1277-004chr17:
67532673-67532677
TTGACTintronicDe novo--Yuen2017 G
MAP2K6     3-0781-000chr17:
67442275-67442275
GAintronicDe novo--Trost2022 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More