or
or
Exact

Results for "FAM47C"

Variant Events: 16

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
FAM47C     AU3915301chrX:
36839952-36839956
TTTTTTTTTTGTTTTintergenicDe novo--Yuen2017 G
FAM47C     AU4122301chrX:
36839951-36839956
TTTTTTTTTTTTGTTTTTintergenicDe novo--Yuen2017 G
FAM47C     MCD-024-3chrX:
37027640-37027640
GAexonicMaternalnonsynonymous SNVNM_001013736c.G1157Ap.R386H6.6183.427E-5Tuncay2023 G
FAM47C     08C76612chrX:
37027433-37027649
ATCTCCGCCCAGAGCCTTCTGAGACTGGAGTGTCCCATCTCCACCCAGAGCCTCCCAAGACTCTGGTGTCCAGTCTCCACCCAGAGCCTCCCGAGACTGGAGTGTCCCATCTCTGCCCGGAACCTCCAGAGACTCGCGTATCTCCTCTCCGCCAGCTGCCTCCCGAGGCTGGAGTGTCCCATCTCTGCCCGGAACCTCCCAAGACTCGCGTACCTCCAexonicDe novononframeshift deletionNM_001013736c.951_1166delp.317_389del-1.141E-5Satterstrom2020 E
Trost2022 G
Zhou2022 GE
FAM47C     SP0021312chrX:
37027725-37027725
CGexonicsynonymous SNVNM_001013736c.C1242Gp.L414L--Zhou2022 GE
FAM47C     5-0099-003chrX:
37031268-37031268
AGintergenicDe novo--Yuen2017 G
FAM47C     2-1384-003chrX:
36839952-36839956
TTTTTTTTTTGTTTTintergenicDe novo--Yuen2017 G
FAM47C     2-1579-003chrX:
36983086-36983097
ATTTTTTTTTTTATTTTTTTTTTintergenicDe novo--Yuen2017 G
FAM47C     SMHC01812s000chrX:
37028209-37028209
GAexonicDe novononsynonymous SNVNM_001013736c.G1726Ap.D576N13.24.0E-4Yuan2023 E
FAM47C     1-0985-003chrX:
36955100-36955135
AAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGGAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGintergenicDe novo--Yuen2017 G
FAM47C     AU045512chrX:
36988200-36988200
CTintergenicDe novo--Yuen2017 G
FAM47C     AU2162302chrX:
36839951-36839956
TTTTTTTTTTTTGTTTTTintergenicDe novo--Yuen2017 G
FAM47C     AU4336301chrX:
36839953-36839956
TTTTTTTTGTTTintergenicDe novo--Yuen2017 G
FAM47C     1-0652-004chrX:
36799639-36799639
GAintergenicDe novo--Yuen2017 G
FAM47C     2-0309-004chrX:
36700464-36700464
ACintergenicDe novo--Yuen2017 G
FAM47C     AU3692302chrX:
36608602-36608602
CTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More