or
or
Exact

Results for "GTF2I"

Variant Events: 16

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
GTF2I     1-0347-003chr7:
74089137-74089138
CTACintronicDe novo--Trost2022 G
GTF2I     SMHC01933s000chr7:
74103487-74103487
CTexonicDe novononsynonymous SNVNM_001163636
NM_001280800
NM_001518
NM_032999
NM_033000
NM_033001
c.C25T
c.C25T
c.C25T
c.C25T
c.C25T
c.C25T
p.L9F
p.L9F
p.L9F
p.L9F
p.L9F
p.L9F
17.43-Yuan2023 E
GTF2I     1-0484-003chr7:
74099800-74099800
CAintronicDe novo--Trost2022 G
Yuen2017 G
GTF2I     REACH000349chr7:
74114630-74114630
CTexonicDe novostopgainNM_001163636
NM_001280800
NM_001518
NM_032999
NM_033000
NM_033001
c.C427T
c.C427T
c.C427T
c.C427T
c.C427T
c.C427T
p.R143X
p.R143X
p.R143X
p.R143X
p.R143X
p.R143X
18.54-Antaki2022 GE
Trost2022 G
Zhou2022 GE
GTF2I     1-0625-003chr7:
74089197-74089199
AGATGTTATTTTATTTATTTATintronicDe novo--Trost2022 G
GTF2I     3-0191-000chr7:
74096846-74096846
GAintronicDe novo--Trost2022 G
GTF2I     7-0232-003chr7:
74089184-74089184
AAGTintronicDe novo--Trost2022 G
GTF2I     1-0138-003chr7:
74089196-74089199
GAGATATCTGTTTGTTintronicDe novo--Trost2022 G
GTF2I     5-0077-004chr7:
74089184-74089184
AAGTintronicDe novo--Trost2022 G
GTF2I     1-0138-003chr7:
74089184-74089184
AAGTintronicDe novo--Trost2022 G
GTF2I     1-0347-003chr7:
74089146-74089147
TGCAintronicDe novo--Trost2022 G
GTF2I     1-0271-004chr7:
74089176-74089176
AATGGGTTGintronicDe novo--Trost2022 G
GTF2I     1-0553-003chr7:
74089184-74089184
AAGTintronicDe novo--Trost2022 G
Yuen2017 G
GTF2I     1-0488-003chr7:
74157951-74157951
AGintronicDe novo--Yuen2017 G
GTF2I     AU2485305chr7:
74147316-74147316
TAintronicDe novo--Yuen2017 G
GTF2I     Wang2023:743chr7:
74114762-74114762
TGsplicingDe novosplicing19.85-Wang2023 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More