or
or
Exact

Results for "ANKLE2"

Variant Events: 44

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ANKLE2     1-0597-003chr12:
133319328-133319328
GAintronicDe novo--Trost2022 G
ANKLE2     1-0018-004chr12:
133319332-133319335
ATTGCTCAintronicDe novo--Trost2022 G
ANKLE2     2-0310-004chr12:
133319318-133319318
ATCACAACCATTATCCTintronicDe novo--Trost2022 G
ANKLE2     2-1505-004chr12:
133319318-133319318
ATTATCCTintronicDe novo--Trost2022 G
ANKLE2     7-0202-003chr12:
133319314-133319314
GATCAintronicDe novo--Trost2022 G
ANKLE2     1-0473-003chr12:
133319318-133319318
ATCACAACCATTATCCTintronicDe novo--Trost2022 G
ANKLE2     7-0002-003chr12:
133319293-133319293
GAintronicDe novo--Yuen2017 G
ANKLE2     1-0473-003chr12:
133319314-133319314
GATCAintronicDe novo--Trost2022 G
ANKLE2     2-0310-004chr12:
133319314-133319314
GATCAintronicDe novo--Trost2022 G
ANKLE2     1-0330-003chr12:
133319360-133319360
TTGAintronicDe novo--Trost2022 G
ANKLE2     SMHC01208s000chr12:
133306665-133306665
GGTexonicDe novoframeshift insertionNM_015114c.2082dupAp.H695fs--Yuan2023 E
ANKLE2     1-0330-003chr12:
133319362-133319362
CCACAintronicDe novo--Trost2022 G
ANKLE2     10-0010-003chr12:
133319352-133319352
CCACCATCATCCTCAACACAACCATCATCACTintronicDe novo--Trost2022 G
ANKLE2     7-0457-004chr12:
133319356-133319356
ACintronicDe novo--Trost2022 G
ANKLE2     2-1277-003chr12:
133319349-133319349
CCACTintronicDe novo--Trost2022 G
ANKLE2     7-0100-003chr12:
133319352-133319352
CCACCATCATCCTCAACACAACCATCATCACTintronicDe novo--Trost2022 G
ANKLE2     2-1391-003chr12:
133319385-133319385
CCAGCATCACAintronicDe novo--Yuen2017 G
ANKLE2     4-0054-003chr12:
133319336-133319336
CCATintronicDe novo--Trost2022 G
ANKLE2     2-0126-004chr12:
133319348-133319348
TTCACCACTACintronicDe novo--Trost2022 G
ANKLE2     REACH000582chr12:
133323868-133323868
ACintronicDe novo--Trost2022 G
ANKLE2     1-1003-003Achr12:
133323987-133323987
TAintronicDe novo--Trost2022 G
ANKLE2     1-0330-003chr12:
133319384-133319384
TTCCTCACintronicDe novo--Trost2022 G
ANKLE2     MSSNG00031-003chr12:
133323340-133323340
CTintronicDe novo--Trost2022 G
ANKLE2     SP0093553chr12:
133319803-133319803
CTexonicDe novosynonymous SNVNM_015114c.G1290Ap.V430V-8.29E-6Fu2022 E
Trost2022 G
Zhou2022 GE
ANKLE2     SP0106656chr12:
133306592-133306592
GCexonicDe novononsynonymous SNVNM_015114c.C2156Gp.P719R8.36-Fu2022 E
Trost2022 G
Zhou2022 GE
ANKLE2     1-0054-004chr12:
133319410-133319410
AATintronicDe novo--Yuen2017 G
ANKLE2     1-0344-003chr12:
133319383-133319383
AACATCTintronicDe novo--Yuen2017 G
ANKLE2     1-0201-004chr12:
133319410-133319410
AATintronicDe novo--Yuen2017 G
ANKLE2     1-0269-005chr12:
133304391-133304391
CTintronicDe novo--Trost2022 G
Yuen2017 G
ANKLE2     5-0055-003chr12:
133319385-133319385
CCATCACTintronicDe novo--Yuen2017 G
ANKLE2     5-0129-003chr12:
133319352-133319352
CCACCATCATCCTCAACACAACCATCATCACTintronicDe novo--Trost2022 G
Yuen2017 G
ANKLE2     MSSNG00054-005chr12:
133304143-133304143
GAintronicDe novo--Trost2022 G
ANKLE2     12694.p1chr12:
133317977-133317977
CTintronicDe novo-2.486E-5Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
ANKLE2     2-1258-004chr12:
133319415-133319415
CCACAACCAintronicDe novo--Yuen2017 G
ANKLE2     1-0555-003chr12:
133319390-133319390
TTCACCACintronicDe novo--Yuen2017 G
ANKLE2     2-1505-004chr12:
133319313-133319314
TGAAintronicDe novo--Trost2022 G
ANKLE2     7-0233-003chr12:
133319313-133319314
TGAAintronicDe novo--Trost2022 G
ANKLE2     mAGRE5672chr12:
133327280-133327280
GGTexonicPaternalframeshift insertionNM_015114c.795dupAp.P266fs-6.625E-5Cirnigliaro2023 G
ANKLE2     7-0233-003chr12:
133319301-133319301
CCATAATCATCACTintronicDe novo--Trost2022 G
ANKLE2     1-0018-004chr12:
133319312-133319314
CTGTCAintronicDe novo--Trost2022 G
ANKLE2     SSC05351chr12:
133317977-133317977
CTintronicDe novo-2.486E-5Trost2022 G
ANKLE2     1-0018-004chr12:
133319300-133319302
TCACCGintronicDe novo--Trost2022 G
ANKLE2     SJD_45.3chr12:
133308567-133308567
GAintronicDe novo--Trost2022 G
ANKLE2     SP0143965chr12:
133311947-133311947
ACintronicDe novo--Trost2022 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More