or
or
Exact

Results for "COL9A1"

Variant Events: 23

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
COL9A1     NDAR_INVAZ651VGG_wes1chr6:
70979999-70979999
ACintronicDe novo-1.664E-5Fu2022 E
Kosmicki2017 E
Satterstrom2020 E
Trost2022 G
COL9A1     1-0511-003chr6:
71066345-71066360
TACCACCACCACCACCTACCACCACCACCintergenicDe novo--Yuen2017 G
COL9A1     2-1235-004chr6:
71020454-71020454
ATintergenicDe novo--Yuen2017 G
COL9A1     1-0052-003chr6:
70964557-70964557
CGintronicDe novo--Trost2022 G
Yuen2017 G
COL9A1     7-0001-003chr6:
70944079-70944079
CAintronicDe novo--Trost2022 G
Yuen2017 G
COL9A1     1-0329-003chr6:
71004874-71004874
TCintronicDe novo--Trost2022 G
Yuen2017 G
COL9A1     1-0579-003chr6:
71038698-71038702
AGGGGAGGGintergenicDe novo--Yuen2017 G
COL9A1     1-0745-003chr6:
71033025-71033025
CTintergenicDe novo--Yuen2017 G
COL9A1     1-0141-003chr6:
71081044-71081044
TCintergenicDe novo--Yuen2017 G
COL9A1     PN400579chr6:
70972993-70972993
TCexonicInheritednonsynonymous SNVNM_078485
NM_001851
c.A620G
c.A1349G
p.E207G
p.E450G
17.410.0049Leblond2019 E
COL9A1     PN400498chr6:
70972993-70972993
TCexonicInheritednonsynonymous SNVNM_078485
NM_001851
c.A620G
c.A1349G
p.E207G
p.E450G
17.410.0049Leblond2019 E
COL9A1     AU1933301chr6:
71001869-71001869
GTintronicDe novo--Trost2022 G
Yuen2017 G
COL9A1     SP0040138chr6:
70965134-70965134
CAintronicDe novo--Fu2022 E
COL9A1     PN400582chr6:
70972993-70972993
TCexonicInheritednonsynonymous SNVNM_078485
NM_001851
c.A620G
c.A1349G
p.E207G
p.E450G
17.410.0049Leblond2019 E
COL9A1     AU3368302chr6:
70985191-70985191
TCintronicDe novo--Trost2022 G
Yuen2017 G
COL9A1     AU002903chr6:
70996215-70996215
TCintronicDe novo--Yuen2017 G
COL9A1     7-0427-003chr6:
71011892-71011893
GTGintronicDe novo--Trost2022 G
COL9A1     2-1617-003chr6:
70937924-70937924
GAintronicDe novo--Trost2022 G
Yuen2017 G
COL9A1     REACH000198chr6:
70943299-70943299
GAintronicDe novo--Trost2022 G
COL9A1     SP0027460chr6:
70992833-70992833
AGUTR5De novo--Fu2022 E
Trost2022 G
COL9A1     SP0120586chr6:
70990435-70990435
TCintronicDe novo--Fu2022 E
COL9A1     SMHC01653s000chr6:
70942441-70942441
CTexonicDe novononsynonymous SNVNM_078485
NM_001851
c.G1619A
c.G2348A
p.R540H
p.R783H
22.33.547E-5Yuan2023 E
COL9A1     AU3761301chr6:
71099951-71099951
AGintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More