or
or
Exact

Results for "CDH4"

Variant Events: 232

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CDH4     2-1751-003chr20:
60145940-60145940
TCintronicDe novo--Trost2022 G
CDH4     13324.p1chr20:
60377505-60377505
GTintronicDe novo--Turner2016 G
CDH4     1-0357-003chr20:
60144336-60144337
GCATintronicDe novo--Trost2022 G
CDH4     MSSNG00004-004chr20:
60140231-60140231
GAintronicDe novo--Trost2022 G
CDH4     AU4269301chr20:
60121193-60121193
GAintronicDe novo--Trost2022 G
CDH4     2-1283-004chr20:
59906745-59906745
CAintronicDe novo--Yuen2017 G
CDH4     5-5159-003chr20:
60121193-60121193
GAintronicDe novo--Trost2022 G
CDH4     MSSNG00019-004Achr20:
60118911-60118911
GAintronicDe novo--Trost2022 G
CDH4     A8chr20:
60442936-60442936
AGintronicDe novo--Wu2018 G
CDH4     AU3765302chr20:
60311861-60311861
CTintronicDe novo--Yuen2017 G
CDH4     2-1788-003chr20:
60114572-60114572
GAintronicDe novo--Trost2022 G
CDH4     MSSNG00256-004chr20:
60057439-60057439
GAintronicDe novo--Trost2022 G
CDH4     MT_99.3chr20:
60216670-60216670
TCintronicDe novo--Trost2022 G
CDH4     MSSNG00085-003chr20:
60203275-60203275
CTintronicDe novo--Trost2022 G
CDH4     1-1182-003chr20:
60201907-60201907
CGintronicDe novo--Trost2022 G
CDH4     4-0064-003chr20:
60193898-60193898
GAintronicDe novo--Trost2022 G
CDH4     1-1167-003chr20:
60181563-60181563
GAintronicDe novo--Trost2022 G
CDH4     1-1122-003chr20:
60159667-60159667
GAintronicDe novo--Trost2022 G
CDH4     5-5014-003chr20:
60157668-60157668
GAintronicDe novo--Trost2022 G
CDH4     MSSNG00023-004chr20:
60146930-60146930
GAintronicDe novo--Trost2022 G
CDH4     MT_181.4chr20:
60271085-60271085
GAintronicDe novo--Trost2022 G
CDH4     14-547chr20:
60265228-60265228
AGintronicDe novo--Trost2022 G
CDH4     7-0347-003chr20:
60259350-60259350
CTintronicDe novo--Trost2022 G
CDH4     7-0309-003chr20:
60234787-60234787
GTintronicDe novo--Trost2022 G
CDH4     1-0158-012chr20:
59906686-59906686
GGACCCGACCACCTCintronicDe novo--Yuen2017 G
CDH4     2-1261-003chr20:
59912378-59912378
AACAGintronicDe novo--Yuen2017 G
CDH4     5-0043-003chr20:
60220430-60220430
CAintronicDe novo--Trost2022 G
CDH4     5-5146-003chr20:
60219150-60219150
CTintronicDe novo--Trost2022 G
CDH4     1-0632-003chr20:
59912392-59912392
GGATCATAintronicDe novo--Yuen2017 G
CDH4     MT_99.3chr20:
60216676-60216676
TCintronicDe novo--Trost2022 G
CDH4     1-0632-003chr20:
59906634-59906634
CAintronicDe novo--Yuen2017 G
CDH4     REACH000405chr20:
60216670-60216670
TCintronicDe novo--Trost2022 G
CDH4     AU2381302chr20:
60097137-60097137
GTintronicDe novo--Yuen2017 G
CDH4     5-1043-003chr20:
60365394-60365394
CTintronicDe novo--Trost2022 G
CDH4     5-0017-003 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
CDH4     1-1196-003chr20:
60327683-60327683
CAintronicDe novo--Trost2022 G
CDH4     2-1261-003chr20:
60080678-60080678
AGintronicDe novo--Trost2022 G
Yuen2017 G
CDH4     1-0760-003chr20:
60308452-60308452
GAintronicDe novo--Trost2022 G
CDH4     REACH000767chr20:
60299092-60299092
AGintronicDe novo--Trost2022 G
CDH4     7-0326-003chr20:
60296790-60296790
GAintronicDe novo--Trost2022 G
CDH4     2-1505-003chr20:
60316100-60316100
AGintronicDe novo--Trost2022 G
Yuen2017 G
CDH4     5-5170-003chr20:
60287511-60287511
GCintronicDe novo--Trost2022 G
CDH4     MT_27.3chr20:
60275399-60275399
CTintronicDe novo--Trost2022 G
CDH4     2-1437-003chr20:
60376693-60376693
CAintronicDe novo--Trost2022 G
CDH4     MSSNG00173-003chr20:
60371595-60371595
GAintronicDe novo--Trost2022 G
CDH4     2-0202-004chr20:
60370167-60370167
GGTGAintronicDe novo--Yuen2017 G
CDH4     1-0455-003chr20:
60370108-60370108
GGTAATintronicDe novo--Trost2022 G
CDH4     1-0271-003chr20:
60370108-60370108
GGTAATintronicDe novo--Trost2022 G
CDH4     2-1620-003chr20:
60370108-60370108
GTAATGGTintronicDe novo--Trost2022 G
CDH4     2-1306-003chr20:
60370106-60370107
GAAATGGintronicDe novo--Trost2022 G
CDH4     1-0271-003chr20:
60370106-60370106
GGGTGATGATGATGGTintronicDe novo--Trost2022 G
CDH4     2-1437-004chr20:
60370098-60370099
TTATGATGGintronicDe novo--Trost2022 G
CDH4     5-0040-003chr20:
60398468-60398468
ATAGTGTTGATGGTintronicDe novo--Trost2022 G
CDH4     5-0040-003chr20:
60398461-60398461
AATGGintronicDe novo--Trost2022 G
CDH4     1-0336-003chr20:
60398461-60398461
AATCATGGintronicDe novo--Trost2022 G
CDH4     5-0015-003chr20:
60370191-60370191
AATGGintronicDe novo--Yuen2017 G
CDH4     1-0336-003chr20:
60398454-60398454
TTGGTGintronicDe novo--Trost2022 G
CDH4     5-0040-003chr20:
60398454-60398454
TTGGTGintronicDe novo--Trost2022 G
CDH4     1-0329-003chr20:
60398431-60398431
GGTAATGGTGATGGTGGTGATGATintronicDe novo--Trost2022 G
CDH4     1-0467-003chr20:
60398425-60398425
AATAGTGTTGATGGTGGTGATGGTGTintronicDe novo--Trost2022 G
CDH4     1-0051-005chr20:
60370133-60370133
GGTAintronicDe novo--Yuen2017 G
CDH4     2-0300-003chr20:
60398415-60398418
TACAGATAGTGTTGATGGTGGTGATGGTGTTGATGGTAATGGTGATGGTGintronicDe novo--Trost2022 G
CDH4     4-0062-003chr20:
60459463-60459464
TGCTintronicDe novo--Trost2022 G
CDH4     MT_75.3chr20:
60459329-60459329
GAintronicDe novo--Trost2022 G
CDH4     3-0193-000chr20:
60436552-60436552
CTintronicDe novo--Trost2022 G
CDH4     5-5046-006chr20:
60433844-60433844
GAintronicDe novo--Trost2022 G
CDH4     1-0844-003chr20:
60429988-60429988
GCintronicDe novo--Trost2022 G
CDH4     1-0336-003chr20:
60398470-60398470
GGTAGTGGTAGTGATGGTGGTGATGATGGTGAintronicDe novo--Trost2022 G
CDH4     AU4219302chr20:
60334147-60334147
CTintronicDe novo--Trost2022 G
Yuen2017 G
CDH4     1-0336-003chr20:
60398468-60398468
ATintronicDe novo--Trost2022 G
CDH4     1-0206-003chr20:
59906714-59906714
CAintronicDe novo--Yuen2017 G
CDH4     1-0289-003chr20:
60398468-60398468
AATGGTGATGGTGGTGATGATCATintronicDe novo--Trost2022 G
CDH4     1-1010-003chr20:
60495132-60495132
GAintronicDe novo--Trost2022 G
CDH4     3-0436-000chr20:
60494921-60494921
GAintronicDe novo--Trost2022 G
CDH4     2-1129-003chr20:
60494921-60494921
GAintronicDe novo--Trost2022 G
CDH4     1-0485-003chr20:
60486697-60486697
AGintronicDe novo--Trost2022 G
CDH4     7-0396-003chr20:
60483903-60483903
GAintronicDe novo--Trost2022 G
CDH4     13221.p1chr20:
59904412-59904412
GAintronicMosaic--Dou2017 E
CDH4     7-0383-003chr20:
60472251-60472251
CTintronicDe novo--Trost2022 G
CDH4     3-0294-000chr20:
60468455-60468455
GAintronicDe novo--Trost2022 G
CDH4     1-0484-003chr20:
59906634-59906634
CAintronicDe novo--Yuen2017 G
CDH4     mAGRE2949chr20:
60499488-60499488
CAexonicMaternalstopgainNM_001252338
NM_001252339
NM_001794
c.C1614A
c.C1503A
c.C1725A
p.Y538X
p.Y501X
p.Y575X
39.0-Cirnigliaro2023 G
CDH4     1-0261-004chr20:
59906638-59906638
CTintronicDe novo--Yuen2017 G
CDH4     2-0215-003chr20:
60370187-60370187
GGATGGTintronicDe novo--Yuen2017 G
CDH4     1-0563-004chr20:
59906682-59906682
TTCCTGACCAAGCCAintronicDe novo--Yuen2017 G
CDH4     AU049304chr20:
60079761-60079761
CTintronicDe novo--Trost2022 G
Yuen2017 G
CDH4     1-0323-003chr20:
59906665-59906665
CAintronicDe novo--Yuen2017 G
CDH4     2-0007-004chr20:
59906640-59906640
CTintronicDe novo--Yuen2017 G
CDH4     7-0082-003chr20:
59906745-59906745
CAintronicDe novo--Trost2022 G
Yuen2017 G
CDH4     AU1795303chr20:
60093454-60093454
GCintronicDe novo--Trost2022 G
Yuen2017 G
CDH4     2-1362-003chr20:
60343519-60343519
CTintronicDe novo--Trost2022 G
Yuen2017 G
CDH4     2-0149-004chr20:
60370191-60370191
AATGGintronicDe novo--Yuen2017 G
CDH4     2-0278-003chr20:
60464792-60464812
TGATGGATGGATGGATGGATGTGATGGATGGATGGATGintronicDe novo--Yuen2017 G
CDH4     1-0401-003chr20:
60370134-60370134
GGGAintronicDe novo--Yuen2017 G
CDH4     AU4145303 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
CDH4     1-0918-003chr20:
60036642-60036642
CTintronicDe novo--Trost2022 G
Yuen2017 G
CDH4     1-0526-003chr20:
60250170-60250170
CTintronicDe novo--Trost2022 G
Yuen2017 G
CDH4     2-0219-004chr20:
60260344-60260344
CAintronicDe novo--Trost2022 G
Yuen2017 G
CDH4     1-0052-004chr20:
60162943-60162943
CAintronicDe novo--Trost2022 G
Yuen2017 G
CDH4     1-0406-003chr20:
60370173-60370173
AATGATGGTAGintronicDe novo--Yuen2017 G
CDH4     2-1406-003chr20:
60251290-60251290
CTintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
CDH4     2-1290-003chr20:
59912378-59912378
AACAGintronicDe novo--Yuen2017 G
CDH4     2-0088-003chr20:
59906736-59906736
CAintronicDe novo--Trost2022 G
Yuen2017 G
CDH4     iHART2949chr20:
60499488-60499488
CAexonicMaternalstopgainNM_001252338
NM_001252339
NM_001794
c.C1614A
c.C1503A
c.C1725A
p.Y538X
p.Y501X
p.Y575X
39.0-Ruzzo2019 G
CDH4     AU057404chr20:
60378768-60378768
GAintronicDe novo--Yuen2017 G
CDH4     AU2137304 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
Yuen2017 G
CDH4     2-0149-005chr20:
59906634-59906634
CAintronicDe novo--Yuen2017 G
CDH4     2-0033-003chr20:
60350429-60350429
GAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
CDH4     1-0299-003chr20:
59906634-59906634
CAintronicDe novo--Yuen2017 G
CDH4     AU2569301chr20:
60322269-60322269
GAintronicDe novo--Trost2022 G
Yuen2017 G
CDH4     1-0161-004chr20:
59906745-59906745
CAintronicDe novo--Trost2022 G
Yuen2017 G
CDH4     SP0094919chr20:
60508111-60508111
AGexonicDe novononsynonymous SNVNM_001252338
NM_001252339
NM_001794
c.A2197G
c.A2086G
c.A2308G
p.I733V
p.I696V
p.I770V
24.3-Fu2022 E
Zhou2022 GE
CDH4     1-0161-004chr20:
60353068-60353068
TTCCACATGCintronicDe novo--Yuen2017 G
CDH4     SP0062502chr20:
60512011-60512011
CAUTR3De novo--Fu2022 E
Trost2022 G
CDH4     11074.p1chr20:
60485668-60485668
GAintronicMosaic, De novo-6.695E-5Dou2017 E
Krumm2015 E
Zhou2022 GE
CDH4     11316.p1chr20:
60148128-60148134
AGATGGTGGAintronicDe novo--Krumm2015 E
CDH4     AU3716301chr20:
60129443-60129443
GAintronicDe novo--Yuen2017 G
CDH4     2-1290-004chr20:
59906634-59906634
CAintronicDe novo--Yuen2017 G
CDH4     1-0339-004chr20:
60399189-60399189
CGintronicDe novo--Trost2022 G
Yuen2017 G
CDH4     12894.p1chr20:
59904350-59904350
GCintronicMosaic Pat.--Dou2017 E
CDH4     2-0045-003chr20:
59867546-59867546
ACintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
CDH4     1-0402-004chr20:
60370178-60370178
GGGTGATGGTAintronicDe novo--Yuen2017 G
CDH4     2-1176-003chr20:
59906729-59906729
CTintronicDe novo--Yuen2017 G
CDH4     SMHC01887d000chr20:
60485580-60485580
CTexonicDe novononsynonymous SNVNM_001252338
NM_001252339
NM_001794
c.C1180T
c.C1069T
c.C1291T
p.R394C
p.R357C
p.R431C
13.61-Yuan2023 E
CDH4     7-0095-004chr20:
59906690-59906690
CCGGCCACCTGCCCTintronicDe novo--Yuen2017 G
CDH4     5-0017-004chr20:
59906640-59906640
CTintronicDe novo--Yuen2017 G
CDH4     5-0017-004chr20:
60370191-60370191
AATGGintronicDe novo--Yuen2017 G
CDH4     AU1223301chr20:
60428658-60428658
CTintronicDe novo--Trost2022 G
Yuen2017 G
CDH4     2-1339-003chr20:
59906634-59906634
CAintronicDe novo--Yuen2017 G
CDH4     1-0551-004chr20:
59906727-59906727
CCACCTCCTGCCCCAGCCACCTGCCTCAGATCTintronicDe novo--Yuen2017 G
CDH4     5-0014-003chr20:
59906634-59906634
CAintronicDe novo--Yuen2017 G
CDH4     1-0248-003chr20:
60481985-60481985
CTintronicDe novo--Yuen2017 G
CDH4     1-0495-003chr20:
59906014-59906014
ACintronicDe novo--Trost2022 G
Yuen2017 G
CDH4     2-0068-003chr20:
60455833-60455833
GAintronicDe novo--Trost2022 G
Yuen2017 G
CDH4     1-0186-005chr20:
60398352-60398352
AGintronicDe novo--Yuen2017 G
CDH4     1-0466-003chr20:
60379296-60379296
GTintronicDe novo--Trost2022 G
Yuen2017 G
CDH4     1-0935-003chr20:
60495974-60495980
CGTGGTGCGTGintronicDe novo--Yuen2017 G
CDH4     AU4029301chr20:
60446074-60446074
AGintronicDe novo--Yuen2017 G
CDH4     1-0565-004chr20:
59853930-59853930
TCintronicDe novo--Trost2022 G
Yuen2017 G
CDH4     1-0359-003chr20:
60445410-60445410
GAintronicDe novo--Trost2022 G
Yuen2017 G
CDH4     1-0305-004chr20:
59906727-59906727
CCAGATCTintronicDe novo--Yuen2017 G
CDH4     1-0414-005chr20:
60370191-60370191
AATGGintronicDe novo--Yuen2017 G
CDH4     2-1085-003chr20:
60440954-60440954
GTintronicDe novo--Trost2022 G
Yuen2017 G
CDH4     1-0022-004chr20:
59949618-59949618
GAintronicDe novo--Trost2022 G
Yuen2017 G
CDH4     2-1382-003chr20:
60220359-60220359
ACintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
CDH4     1-0175-004chr20:
59906634-59906634
CAintronicDe novo--Yuen2017 G
CDH4     1-0051-004chr20:
59906665-59906665
CAintronicDe novo--Yuen2017 G
CDH4     AU3398301chr20:
60412227-60412227
CTintronicDe novo--Trost2022 G
Yuen2017 G
CDH4     1-0552-003chr20:
60206299-60206299
GCintronicDe novo--Trost2022 G
Yuen2017 G
CDH4     1-0218-004chr20:
60499957-60499957
TTCintronicDe novo--Trost2022 G
Yuen2017 G
CDH4     AU2035302chr20:
60495843-60495846
GGTAGintronicDe novo--Yuen2017 G
CDH4     5-0018-003chr20:
60370191-60370191
AATGGintronicDe novo--Yuen2017 G
CDH4     3-0484-000chr20:
59880034-59880034
GAintronicDe novo--Trost2022 G
CDH4     MT_168.3chr20:
59879653-59879653
AGintronicDe novo--Trost2022 G
CDH4     1-0252-003chr20:
60105563-60105563
TCintronicDe novo--Trost2022 G
Yuen2017 G
CDH4     1-1174-003chr20:
59856660-59856660
CTintronicDe novo--Trost2022 G
CDH4     MSSNG00452-003chr20:
59847969-59847969
GAintronicDe novo--Trost2022 G
CDH4     MT_20.3chr20:
59847947-59847947
GTintronicDe novo--Trost2022 G
CDH4     1-0533-003chr20:
59906648-59906648
AGintronicDe novo--Trost2022 G
CDH4     1-0481-003chr20:
59906682-59906682
TTCCTGACCAAGCCAintronicDe novo--Yuen2017 G
CDH4     1-0553-003chr20:
59906641-59906641
CTintronicDe novo--Trost2022 G
CDH4     5-0026-003chr20:
59906636-59906639
TGCCACCTintronicDe novo--Trost2022 G
CDH4     1-0533-003chr20:
59906636-59906639
TGCCACCTintronicDe novo--Trost2022 G
CDH4     MT_34.3chr20:
59906632-59906632
CTintronicDe novo--Trost2022 G
CDH4     5-0055-003chr20:
59904380-59904380
AGintronicDe novo--Trost2022 G
CDH4     7-0256-003chr20:
59882526-59882526
CTintronicDe novo--Trost2022 G
Yuen2017 G
CDH4     MSSNG00392-003chr20:
59888267-59888267
AGintronicDe novo--Trost2022 G
CDH4     1-0344-003chr20:
60473263-60473263
GAintronicDe novo--Yuen2017 G
CDH4     1-0173-004chr20:
59881403-59881403
TTTTTTTCTTTCTTTTTCintronicDe novo--Trost2022 G
CDH4     1-0201-004chr20:
59906656-59906656
CAintronicDe novo--Trost2022 G
CDH4     1-0043-003chr20:
59906652-59906655
CCTGGCintronicDe novo--Trost2022 G
CDH4     5-0033-004chr20:
59906634-59906634
CAintronicDe novo--Yuen2017 G
CDH4     1-0533-003chr20:
59906651-59906652
TCAAintronicDe novo--Trost2022 G
CDH4     1-0059-003chr20:
60352677-60352677
TTCCACATGCGCACACACAGintronicDe novo--Yuen2017 G
CDH4     5-0026-003chr20:
59906651-59906652
TCAAintronicDe novo--Trost2022 G
CDH4     2-1719-003chr20:
60025798-60025798
GAintronicDe novo--Trost2022 G
Yuen2017 G
CDH4     1-0271-004chr20:
59906651-59906651
TAintronicDe novo--Trost2022 G
CDH4     1-0169-003chr20:
60370187-60370187
GGATGGTintronicDe novo--Yuen2017 G
CDH4     1-0043-003chr20:
59906649-59906649
CAintronicDe novo--Trost2022 G
CDH4     1-0138-003chr20:
59906649-59906649
CTintronicDe novo--Trost2022 G
CDH4     5-0026-003chr20:
59906648-59906648
AGintronicDe novo--Trost2022 G
CDH4     2-1410-003chr20:
59906658-59906665
CCGGCCACTCAGATintronicDe novo--Trost2022 G
CDH4     7-0227-003chr20:
59906656-59906656
CAintronicDe novo--Trost2022 G
CDH4     10-1104-004chr20:
59906656-59906656
CAintronicDe novo--Trost2022 G
CDH4     2-1306-003chr20:
59906656-59906656
CAintronicDe novo--Trost2022 G
CDH4     4-0039-003chr20:
59906656-59906656
CAintronicDe novo--Trost2022 G
CDH4     1-0206-004chr20:
59906656-59906656
CAintronicDe novo--Trost2022 G
CDH4     1-0551-003chr20:
59906656-59906656
CAintronicDe novo--Trost2022 G
CDH4     2-1638-003chr20:
59906656-59906656
CAintronicDe novo--Trost2022 G
CDH4     AU3913303chr20:
59906736-59906736
CAintronicDe novo--Trost2022 G
CDH4     2-1281-003chr20:
59906736-59906736
CAintronicDe novo--Trost2022 G
CDH4     MT_21.3chr20:
59906721-59906721
CAintronicDe novo--Trost2022 G
CDH4     2-1562-004chr20:
59906713-59906713
ATintronicDe novo--Trost2022 G
CDH4     1-0300-003chr20:
60370191-60370191
AATGGintronicDe novo--Yuen2017 G
CDH4     1-0541-003chr20:
59906713-59906713
ATintronicDe novo--Trost2022 G
CDH4     1-0218-003chr20:
59906713-59906713
ATintronicDe novo--Trost2022 G
CDH4     2-0309-004chr20:
59906672-59906672
CTintronicDe novo--Trost2022 G
CDH4     2-0145-004chr20:
59906662-59906662
CTintronicDe novo--Trost2022 G
CDH4     2-0144-003chr20:
59906740-59906740
GCintronicDe novo--Trost2022 G
CDH4     1-0150-003chr20:
59906665-59906665
CAintronicDe novo--Yuen2017 G
CDH4     1-0731-003chr20:
59906736-59906736
CAintronicDe novo--Trost2022 G
CDH4     2-1366-004chr20:
59906736-59906736
CAintronicDe novo--Trost2022 G
CDH4     2-1638-003chr20:
59906736-59906736
CAintronicDe novo--Trost2022 G
CDH4     2-0112-005chr20:
59906736-59906736
CAintronicDe novo--Trost2022 G
CDH4     2-1335-004chr20:
59906736-59906736
CAintronicDe novo--Yuen2017 G
CDH4     3-0025-000chr20:
59906736-59906736
CAintronicDe novo--Trost2022 G
CDH4     2-0309-004chr20:
59906736-59906736
CAintronicDe novo--Trost2022 G
CDH4     2-1366-003chr20:
60370166-60370166
GGATGGTAintronicDe novo--Yuen2017 G
CDH4     MT_6.3chr20:
59906736-59906736
CAintronicDe novo--Trost2022 G
CDH4     MSSNG00371-003chr20:
59961053-59961053
CTintronicDe novo--Trost2022 G
CDH4     4-0010-003chr20:
59934146-59934146
GAintronicDe novo--Trost2022 G
CDH4     MSSNG00034-003chr20:
59929208-59929208
CTintronicDe novo--Trost2022 G
CDH4     MSSNG00254-004chr20:
59925831-59925831
GAintronicDe novo--Trost2022 G
CDH4     2-1357-004chr20:
59906783-59906783
GCCTGCCCTintronicDe novo--Trost2022 G
CDH4     2-0214-004chr20:
60370191-60370191
AATGGintronicDe novo--Yuen2017 G
CDH4     2-0309-004chr20:
59906780-59906783
ACAGCCCCintronicDe novo--Trost2022 G
CDH4     AU3368303chr20:
60017333-60017333
GAintronicDe novo--Yuen2017 G
CDH4     2-1357-004chr20:
59906779-59906780
GACCCCCAGGCTCACCTCCTGCCCCGGCintronicDe novo--Trost2022 G
CDH4     2-0144-003chr20:
59906745-59906745
CAintronicDe novo--Trost2022 G
CDH4     2-0307-004chr20:
60163157-60163157
ACintronicDe novo--Trost2022 G
Yuen2017 G
CDH4     1044chr20:
60038493-60038493
CTintronicDe novo--Trost2022 G
CDH4     1-0994-003chr20:
60019286-60019286
TGintronicDe novo--Trost2022 G
CDH4     2-1164-003chr20:
59930759-59930773
CTGTGTGTGTGTGTGCTGTGTGTGTGTGintronicDe novo--Yuen2017 G
CDH4     2-1336-003chr20:
59999888-59999892
ACAGATCTGTintronicDe novo--Trost2022 G
CDH4     2-1231-003chr20:
59983676-59983676
GAintronicDe novo--Trost2022 G
Yuen2017 G
CDH4     Costa2023:P33-1chr20:
60508149-60508149
GCexonicDe novononsynonymous SNVNM_001252338
NM_001252339
NM_001794
c.G2235C
c.G2124C
c.G2346C
p.K745N
p.K708N
p.K782N
8.624-Costa2023 E
CDH4     2-0270-003chr20:
59999888-59999890
ACATCTGTGCTGTintronicDe novo--Trost2022 G
CDH4     1-0563-003chr20:
59906714-59906714
CAintronicDe novo--Yuen2017 G
CDH4     1-0756-005chr20:
59999831-59999833
TCAAGTintronicDe novo--Trost2022 G
CDH4     MSSNG00047-004Achr20:
59998318-59998318
CTintronicDe novo--Trost2022 G
CDH4     AU1795302chr20:
59965739-59965739
GAintronicDe novo--Trost2022 G
CDH4     AU3984302chr20:
59965687-59965687
CTintronicDe novo--Trost2022 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More