or
or
Exact

Results for "NEXMIF"

Variant Events: 14

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
NEXMIF     Leuven_415034chrX:
73963961-73963961
CTexonicUnknownnonsynonymous SNVNM_001008537c.G431Ap.R144Q23.5-Wang2020 T
NEXMIF     7-0176-003chrX:
73961619-73961619
CCGAAAexonicDe novoframeshift insertionNM_001008537c.2772_2773insTTTCp.E925fs--Wang2020 T
NEXMIF     AU030103chrX:
74015989-74016015
CATATATATTATATATATTATATATATCATATATATTATATATATintronicDe novo--Yuen2017 G
NEXMIF     AU3154301chrX:
74010419-74010419
AGintronicDe novo--Yuen2017 G
NEXMIF     AU3154301chrX:
74010440-74010440
TCintronicDe novo--Yuen2017 G
NEXMIF     AU3728301chrX:
74090584-74090584
AATCAGAGintronicDe novo--Yuen2017 G
NEXMIF     AU3903301chrX:
74055056-74055056
GCintronicDe novo--Yuen2017 G
NEXMIF     2-1373-003chrX:
74251866-74251866
GAintergenicDe novo--Yuen2017 G
NEXMIF     AU3728301chrX:
74090589-74090589
AGintronicDe novo--Yuen2017 G
NEXMIF     1-0925-003chrX:
74010256-74010256
CGintronicDe novo--Yuen2017 G
NEXMIF     Chen2021:16chrX:
73960230-73960230
CTexonicMaternalnonsynonymous SNVNM_001008537c.G4162Ap.A1388T9.3151.14E-5Chen2021 GET
NEXMIF     SF0132961.p1chrX:
73960491-73960491
TAexonicnonsynonymous SNVNM_001008537c.A3901Tp.N1301Y13.09-Wang2020 T
NEXMIF     11290.p1chrX:
73960990-73960990
GTexonicUnknown, De novononsynonymous SNVNM_001008537c.C3402Ap.H1134Q14.881.0E-4Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wang2020 T
NEXMIF     SanDiego_A8Z8MchrX:
73959987-73959987
GAexonicUnknownstopgainNM_001008537c.C4405Tp.R1469X48.02.286E-5Wang2020 T
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More