or
or
Exact

Results for "SRGAP1"

Variant Events: 45

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SRGAP1     AGG0238chr12:
64536115-64536115
GAexonicDe novononsynonymous SNVNM_020762c.G2921Ap.R974Q17.33-Fu2022 E
SRGAP1     MT_21.3chr12:
64271313-64271313
GTintronicDe novo--Trost2022 G
SRGAP1     MT_57.3chr12:
64298202-64298202
GAintronicDe novo--Trost2022 G
SRGAP1     MSSNG00101-003chr12:
64242357-64242357
CGintronicDe novo--Trost2022 G
SRGAP1     5-1007-003chr12:
64255206-64255206
ATintronicDe novo--Trost2022 G
SRGAP1     SP0005107chr12:
64536511-64536515
CAAAACUTR3De novo--Fu2022 E
SRGAP1     MSSNG00109-004chr12:
64364230-64364230
AGintronicDe novo--Trost2022 G
SRGAP1     MSSNG00212-003chr12:
64369114-64369114
CTintronicDe novo--Trost2022 G
SRGAP1     AU2318301chr12:
64341382-64341383
GAGintronicDe novo--Trost2022 G
SRGAP1     AU3712302chr12:
64231503-64231503
GAintergenicDe novo--Yuen2017 G
SRGAP1     1-0549-003chr12:
64456693-64456694
TATintronicDe novo--Trost2022 G
Zhou2022 GE
SRGAP1     MSSNG00419-003chr12:
64342962-64342962
TGintronicDe novo--Trost2022 G
SRGAP1     SJD_74.3chr12:
64333659-64333659
AGintronicDe novo--Trost2022 G
SRGAP1     4-0082-004chr12:
64333800-64333800
GAintronicDe novo--Trost2022 G
SRGAP1     MSSNG00402-003chr12:
64298758-64298758
GAintronicDe novo--Trost2022 G
SRGAP1     1-0649-003chr12:
64314623-64314623
CTintronicDe novo--Trost2022 G
SRGAP1     1-0490-003chr12:
64253023-64253023
CTintronicDe novo--Trost2022 G
Yuen2017 G
SRGAP1     1-0291-003chr12:
64482371-64482371
GAintronicDe novo--Trost2022 G
SRGAP1     SSC02331chr12:
64491022-64491022
TGexonicDe novosynonymous SNVNM_020762c.T1680Gp.G560G-6.0E-4Trost2022 G
SRGAP1     MSSNG00023-003chr12:
64474970-64474971
GAGintronicDe novo--Trost2022 G
SRGAP1     2-1790-003chr12:
64482282-64482282
TCintronicDe novo--Trost2022 G
SRGAP1     1-1022-003Achr12:
64455552-64455552
GAintronicDe novo--Trost2022 G
SRGAP1     MSSNG00231-003chr12:
64459230-64459231
ATAintronicDe novo--Trost2022 G
SRGAP1     7-0354-003chr12:
64405820-64405820
TAintronicDe novo--Trost2022 G
SRGAP1     1-0763-004chr12:
64423571-64423572
GTATCintronicDe novo--Trost2022 G
SRGAP1     AU3057301chr12:
64518504-64518504
AGintronicDe novo--Trost2022 G
Yuen2017 G
SRGAP1     C9C2C_01chr12:
64544761-64544761
GAintergenicDe novo--Trost2022 G
SRGAP1     AU0638302chr12:
64342693-64342705
CATATATATATATCATATATATATintronicDe novo--Yuen2017 G
SRGAP1     REACH000222chr12:
64544761-64544761
GAintergenicDe novo--Trost2022 G
SRGAP1     C9C2C_01chr12:
64544759-64544759
TAintergenicDe novo--Trost2022 G
SRGAP1     REACH000222chr12:
64544759-64544759
TAintergenicDe novo--Trost2022 G
SRGAP1     1-0049-004chr12:
64399526-64399526
ATintronicDe novo--Trost2022 G
Yuen2017 G
SRGAP1     1721001chr12:
64456787-64456787
GAexonicDe novononsynonymous SNVNM_020762c.G892Ap.G298S33.0-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
SRGAP1     2-1410-003chr12:
64499420-64499420
CTintronicDe novo--Trost2022 G
SRGAP1     AU056005chr12:
64482920-64482920
CTintronicDe novo--Trost2022 G
Yuen2017 G
SRGAP1     2-1097-003chr12:
64511304-64511305
CAATintronicDe novo--Trost2022 G
SRGAP1     AU4033305chr12:
64350405-64350405
AGintronicDe novo--Trost2022 G
Yuen2017 G
SRGAP1     A20chr12:
64541446-64541446
GAUTR3De novo--Wu2018 G
SRGAP1     11611.p1chr12:
64491022-64491022
TGexonicDe novosynonymous SNVNM_020762c.T1680Gp.G560G-6.0E-4Satterstrom2020 E
SRGAP1     AU07204chr12:
64519821-64519821
CTexonicDe novosynonymous SNVNM_020762c.C2289Tp.S763S--DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Neale2012 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
SRGAP1     1-0652-004chr12:
64571137-64571137
AGintergenicDe novo--Yuen2017 G
SRGAP1     PN400171chr12:
64521867-64521867
CTexonicUnknownnonsynonymous SNVNM_020762c.C2767Tp.R923W20.36.602E-5Leblond2019 E
SRGAP1     1-0092-003chr12:
64481960-64481960
CTintronicDe novo--Trost2022 G
Yuen2017 G
SRGAP1     AU3154302chr12:
64435358-64435358
CTintronicDe novo--Trost2022 G
Yuen2017 G
SRGAP1     SP0054404chr12:
64505577-64505578
CTCexonicDe novoframeshift deletionNM_020762c.1956delTp.P652fs--Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More