
Results for "OBSL1"

Variant Events: 14

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
OBSL1     SP0126368chr2:
GAexonicDe novosynonymous SNVNM_001173408
-8.301E-6Fu2022 E
Trost2022 G
Zhou2022 GE
OBSL1     1717_14mrchr2:
GTexonicDe novosynonymous SNVNM_001173431
1.427-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
OBSL1     SP0071005chr2:
CTexonicDe novononsynonymous SNVNM_001173408
14.442.83E-5Fu2022 E
Trost2022 G
Zhou2022 GE
OBSL1     mAGRE1553chr2:
CCCCTCCCTAGGTCCCGGGCTCCGCCGTACCTTTCACexonicPaternalnonframeshift deletionNM_001173408
--Cirnigliaro2023 G
OBSL1     10C101480chr2:
CTexonicDe novononsynonymous SNVNM_001173431
20.99.307E-5DeRubeis2014 E
Kosmicki2017 E
Neale2012 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
OBSL1     mAGRE2382chr2:
44.03.0E-4Cirnigliaro2023 G
OBSL1     AU3646301chr2:
44.03.0E-4Cirnigliaro2023 G
OBSL1     2-1773-003chr2:
GAintronicDe novo--Trost2022 G
OBSL1     mAGRE4876chr2:
CAAGGCexonicMaternalframeshift deletionNM_001173431
--Cirnigliaro2023 G
OBSL1     SJD_10.3chr2:
GAintronicDe novo--Trost2022 G
OBSL1     1-0436-003chr2:
ATintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
OBSL1     2-1176-003chr2:
GAintronicDe novo--Yuen2017 G
OBSL1     iHART1553chr2:
CCCCTCCCTAGGTCCCGGGCTCCGCCGTACCTTTCACexonicPaternalnonframeshift deletionNM_001173408
--Ruzzo2019 G
OBSL1     EGAN00001101277chr2:
ACexonicDe novononsynonymous SNVNM_001173408
21.43.331E-5Satterstrom2020 E
Trost2022 G
Zhou2022 GE
Source Variant Information

, -


Paper alias:

No records found.
Paper Information
Variant source
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView