or
or
Exact

Results for "C10orf90"

Variant Events: 46

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
C10orf90     2-1250-003chr10:
128590711-128590711
TTTAAAintergenicDe novo--Yuen2017 G
C10orf90     AU026604chr10:
128255120-128255120
CTintergenicDe novo--Trost2022 G
Yuen2017 G
C10orf90     5-5011-003chr10:
128352782-128352782
CTintergenicDe novo--Trost2022 G
C10orf90     REACH000409chr10:
128356670-128356670
CTintergenicDe novo--Trost2022 G
C10orf90     AU046506chr10:
128340586-128340586
AGintergenicDe novo--Trost2022 G
C10orf90     5-5217-003chr10:
128344328-128344328
AGintergenicDe novo--Trost2022 G
C10orf90     5-5064-003chr10:
128303243-128303243
TGintergenicDe novo--Trost2022 G
C10orf90     X3N7Y_01chr10:
128336220-128336220
CTintergenicDe novo--Trost2022 G
C10orf90     AU0039303chr10:
128274039-128274039
AGintergenicDe novo--Trost2022 G
C10orf90     MT_33.3chr10:
128299918-128299918
GTintergenicDe novo--Trost2022 G
C10orf90     2-1430-003chr10:
128362598-128362598
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
C10orf90     2-0244-003chr10:
128576629-128576629
TAintergenicDe novo--Yuen2017 G
C10orf90     10C107588chr10:
128118361-128118361
AGexonicDe novosynonymous SNVNM_001004298c.T1956Cp.S652S9.428-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
C10orf90     2-0244-003chr10:
128486444-128486454
CCACTGGGCTTCintergenicDe novo--Yuen2017 G
C10orf90     5-0131-003chr10:
128296185-128296185
GAintergenicDe novo--Trost2022 G
Yuen2017 G
C10orf90     14093.p1chr10:
128446837-128446837
CCTintergenicDe novo--Wilfert2021 G
C10orf90     5090_childchr10:
128118361-128118361
AGexonicDe novosynonymous SNVNM_001004298c.T1956Cp.S652S9.428-Neale2012 E
C10orf90     14563.p1 Complex Event; expand row to view variants  De novoframeshift insertionNM_001004298
NM_001004298
c.207dupC
c.206dupC
p.L70fs
p.S69fs
--Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
Zhou2022 GE
C10orf90     SP0005862chr10:
128213345-128213345
CTintergenicDe novo--Fu2022 E
Trost2022 G
C10orf90     mAGRE4464chr10:
128114562-128114562
TAexonicMaternalstopgainNM_001004298c.A2059Tp.K687X39.0-Cirnigliaro2023 G
C10orf90     AU028305chr10:
128496680-128496680
GTintergenicDe novo--Yuen2017 G
C10orf90     200675704@1082034185chr10:
128158606-128158722
ATGCATGCTGCAGAGAAGGAGGGAAGGTGTTCTTCTGCATGTTGCATACTGCAGGGGGGAAGGCACTCTTCTGCATGTTGTGTCCTGCAGTGGAGGAAAAGGCATTCTTCTGTAGGTAintronicDe novo--Satterstrom2020 E
Trost2022 G
C10orf90     2-1734-003chr10:
128282271-128282271
AGintergenicDe novo--Trost2022 G
Yuen2017 G
C10orf90     2-1314-003chr10:
128420938-128420938
ACintergenicDe novo--Yuen2016 G
C10orf90     AU4284301chr10:
128587095-128587099
AACACAACintergenicDe novo--Yuen2017 G
C10orf90     13515.p1chr10:
128333497-128333497
ATintergenicDe novo--Turner2016 G
C10orf90     36886chr10:
128193561-128193561
AAGexonicDe novoframeshift insertionNM_001004298c.207dupCp.L70fs--Fu2022 E
Trost2022 G
C10orf90     A28chr10:
128168115-128168115
GAintronicDe novo--Wu2018 G
C10orf90     mAGRE4465chr10:
128114562-128114562
TAexonicMaternalstopgainNM_001004298c.A2059Tp.K687X39.0-Cirnigliaro2023 G
C10orf90     2-1715-004chr10:
128234116-128234116
AGintergenicDe novo--Trost2022 G
Yuen2017 G
C10orf90     10-0006-003chr10:
128180147-128180147
GAintronicDe novo--Trost2022 G
C10orf90     5-5011-003chr10:
128203289-128203289
CAintronicDe novo--Trost2022 G
C10orf90     7-0143-004chr10:
128132888-128132888
CGintronicDe novo--Trost2022 G
C10orf90     MSSNG00089-003chr10:
128135040-128135040
GCintronicDe novo--Trost2022 G
C10orf90     1-0191-004chr10:
128471095-128471095
ACintergenicDe novo--Yuen2017 G
C10orf90     1-0197-004chr10:
128396447-128396447
GAintergenicDe novo--Yuen2017 G
C10orf90     MSSNG00045-005chr10:
128272437-128272437
CTintergenicDe novo--Trost2022 G
C10orf90     1-0609-003chr10:
128274039-128274039
AGintergenicDe novo--Trost2022 G
C10orf90     AU3768302chr10:
128551219-128551219
GCintergenicDe novo--Yuen2017 G
C10orf90     4-0046-004chr10:
128262119-128262119
TCintergenicDe novo--Trost2022 G
C10orf90     REACH000246chr10:
128269533-128269533
AGintergenicDe novo--Trost2022 G
C10orf90     10-0010-003chr10:
128231066-128231066
TCintergenicDe novo--Trost2022 G
C10orf90     5-5177-003chr10:
128245854-128245854
TCintergenicDe novo--Trost2022 G
C10orf90     MSSNG00359-003chr10:
128205354-128205354
CTintronicDe novo--Trost2022 G
C10orf90     2-1127-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
C10orf90     4-0007-003chr10:
128219124-128219124
TCintergenicDe novo--Trost2022 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More