or
or
Exact

Results for "NCOR2"

Variant Events: 40

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
NCOR2     12948.p1chr12:
125106918-125106922
CGTACTGCATintergenicInherited--Wilfert2021 G
NCOR2     2-1333-003chr12:
124897746-124897746
CTintronicDe novo--Yuen2017 G
NCOR2     AU3782302chr12:
124807551-124807556
GTATATGTATintergenicDe novo--Yuen2017 G
NCOR2     AU3782302chr12:
125151973-125151973
GAintergenicDe novo--Yuen2017 G
NCOR2     5-0050-003chr12:
124844096-124844101
TGGAGGTintronicDe novo--Yuen2017 G
NCOR2     1-0219-003chr12:
125112246-125112246
GAintergenicDe novo--Yuen2017 G
NCOR2     AU2072302chr12:
125106756-125106756
GAintergenicDe novo--Yuen2017 G
NCOR2     5-0050-004chr12:
124844096-124844101
TGGAGGTintronicDe novo--Yuen2017 G
NCOR2     AU4013301chr12:
124915828-124915829
GAGATAintronicDe novo--Yuen2017 G
NCOR2     Bruno2021:VIIchr12:
124827626-124827626
CTexonicPaternalnonsynonymous SNVNM_001077261
NM_001206654
NM_006312
c.G4831A
c.G4831A
c.G4861A
p.V1611M
p.V1611M
p.V1621M
11.411.701E-5Bruno2021 E
NCOR2     SP0130992chr12:
124821225-124821225
CTintronicDe novo--Fu2022 E
NCOR2     SP0053143chr12:
124829312-124829312
GAexonicDe novosynonymous SNVNM_001077261
NM_001206654
NM_006312
c.C4515T
c.C4515T
c.C4545T
p.A1505A
p.A1505A
p.A1515A
--Fu2022 E
NCOR2     Bruno2021:VIIchr12:
124824869-124824869
GAexonicMaternalnonsynonymous SNVNM_001077261
NM_001206654
NM_006312
c.C5429T
c.C5429T
c.C5459T
p.T1810M
p.T1810M
p.T1820M
8.8530.0047Bruno2021 E
NCOR2     SP0077949chr12:
124841436-124841446
TGGCCTGTGACTintronicDe novo--Fu2022 E
NCOR2     2-1725-003chr12:
124879884-124879884
GAintronicDe novo--Yuen2017 G
NCOR2     2661_18auchr12:
124815498-124815498
CTintronicDe novo--Fu2022 E
NCOR2     SP0061610chr12:
124824560-124824560
CTexonicDe novosynonymous SNVNM_001077261
NM_001206654
NM_006312
c.G5649A
c.G5649A
c.G5679A
p.T1883T
p.T1883T
p.T1893T
9.3215.895E-5Fu2022 E
NCOR2     AU3951301chr12:
124972757-124972757
CGintronicDe novo--Yuen2017 G
NCOR2     5-0131-003chr12:
125082279-125082279
AGintergenicDe novo--Yuen2017 G
NCOR2     2-1137-003chr12:
124844689-124844689
GAintronicDe novo--Yuen2017 G
NCOR2     AU4176302chr12:
125090842-125090842
CTintergenicDe novo--Yuen2017 G
NCOR2     2-0197-004chr12:
124821824-124821824
CAintronicDe novo--Yuen2017 G
NCOR2     1-0296-004chr12:
125139613-125139613
GAintergenicDe novo--Yuen2017 G
NCOR2     SP0002452chr12:
124950670-124950670
GAintronicDe novo-6.87E-5Fu2022 E
NCOR2     14607_p1chr12:
124831242-124831242
CTexonicDe novosynonymous SNVNM_001077261
NM_001206654
NM_006312
c.G4197A
c.G4197A
c.G4227A
p.P1399P
p.P1399P
p.P1409P
-1.0E-4Fu2022 E
NCOR2     AU009904chr12:
124892206-124892206
GAintronicDe novo--Yuen2017 G
NCOR2     AU057405chr12:
125010893-125010893
GAintronicDe novo--Yuen2017 G
NCOR2     11456.p1chr12:
125090768-125090768
GAintergenicDe novo--Turner2016 G
NCOR2     1-0627-003chr12:
125060564-125060564
CTintergenicDe novo--Yuen2017 G
NCOR2     1-0591-003chr12:
124842972-124842985
CTGTGTGTGTGTGTCTGTGTGTGTGTintronicDe novo--Yuen2017 G
NCOR2     2-0305-004chr12:
125232398-125232398
ACintergenicDe novo--Yuen2017 G
NCOR2     14607.p1chr12:
124831242-124831242
CTexonicDe novosynonymous SNVNM_001077261
NM_001206654
NM_006312
c.G4197A
c.G4197A
c.G4227A
p.P1399P
p.P1399P
p.P1409P
-1.0E-4Iossifov2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Wilfert2021 G
NCOR2     13704.p1chr12:
124887011-124887011
TCexonicDe novononsynonymous SNVNM_001077261
NM_001206654
NM_006312
c.A1576G
c.A1576G
c.A1579G
p.K526E
p.K526E
p.K527E
12.39-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
NCOR2     SSC09043chr12:
124887011-124887011
TCexonicDe novononsynonymous SNVNM_001077261
NM_001206654
NM_006312
c.A1576G
c.A1576G
c.A1579G
p.K526E
p.K526E
p.K527E
12.39-Fu2022 E
Lim2017 E
NCOR2     AU0039303chr12:
124901081-124901110
CCCCGCGGCACAGGGAGACCCGCGGCACAGCCCCGCGGCACAGintronicDe novo--Yuen2017 G
NCOR2     2-1153-003chr12:
124834012-124834012
CTintronicDe novo--Yuen2017 G
NCOR2     AU2525302chr12:
125192224-125192224
GAintergenicDe novo--Yuen2017 G
NCOR2     2-1375-003chr12:
124945891-124945891
GAintronicDe novo--Yuen2016 G
Yuen2017 G
NCOR2     1-0024-003chr12:
124901632-124901632
GCintronicDe novo--Yuen2017 G
NCOR2     1-0305-004chr12:
124892925-124892925
TCintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More