or
or
Exact

Results for "POTEH"

Variant Events: 61

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
POTEH     5-0083-003chr22:
16358969-16358969
CGintergenicDe novo--Yuen2017 G
POTEH     AU3808304chr22:
16362538-16362538
GAintergenicDe novo--Yuen2017 G
POTEH     1-0488-003chr22:
16424185-16424185
GTintergenicDe novo--Yuen2017 G
POTEH     AU3874303chr22:
16425649-16425649
AGintergenicDe novo--Yuen2017 G
POTEH     AU3051303chr22:
16296556-16296556
TCintergenicDe novo--Yuen2017 G
POTEH     AU4234303chr22:
16296114-16296114
ACintergenicDe novo--Yuen2017 G
POTEH     7-0219-003chr22:
16319726-16319728
CTTCTintergenicDe novo--Yuen2017 G
POTEH     AU073003chr22:
16357701-16357701
TGintergenicDe novo--Yuen2017 G
POTEH     1-0973-003chr22:
16433410-16433410
CTintergenicDe novo--Yuen2017 G
POTEH     2-0278-003chr22:
16278400-16278400
GAintronicDe novo--Yuen2017 G
POTEH     1-0450-003chr22:
16353470-16353470
TAintergenicDe novo--Yuen2017 G
POTEH     7-0103-003chr22:
16364845-16364845
GAintergenicDe novo--Yuen2017 G
POTEH     AU2129303chr22:
16384066-16384066
CAintergenicDe novo--Yuen2017 G
POTEH     5-0087-003chr22:
16394306-16394306
CGintergenicDe novo--Yuen2017 G
POTEH     AU4242302chr22:
16380831-16380831
CTintergenicDe novo--Yuen2017 G
POTEH     AU3865301chr22:
16378950-16378950
CGintergenicDe novo--Yuen2017 G
POTEH     1-0404-003chr22:
16312194-16312194
TCintergenicDe novo--Yuen2017 G
POTEH     2-1452-003chr22:
16352090-16352090
AGintergenicDe novo--Yuen2017 G
POTEH     1-0404-003chr22:
16298172-16298172
GAintergenicDe novo--Yuen2017 G
POTEH     AU073006chr22:
16357701-16357701
TGintergenicDe novo--Yuen2017 G
POTEH     AU4092302chr22:
16377839-16377839
CTintergenicDe novo--Yuen2017 G
POTEH     AU061003chr22:
16377626-16377626
CTintergenicDe novo--Yuen2017 G
POTEH     AU4092302chr22:
16377854-16377854
GTintergenicDe novo--Yuen2017 G
POTEH     2-1251-003chr22:
16420582-16420582
GAintergenicDe novo--Yuen2017 G
POTEH     AU061003chr22:
16377640-16377640
AGintergenicDe novo--Yuen2017 G
POTEH     5-0045-003chr22:
16420253-16420253
TCintergenicDe novo--Yuen2017 G
POTEH     1-0304-003chr22:
16366268-16366268
TCintergenicDe novo--Yuen2017 G
POTEH     7-0249-004chr22:
16278510-16278510
ACintronicDe novo--Yuen2017 G
POTEH     7-0273-003chr22:
16362969-16362969
ATintergenicDe novo--Yuen2017 G
POTEH     2-1737-003chr22:
16387650-16387650
CTintergenicDe novo--Yuen2017 G
POTEH     1-0629-003chr22:
16294317-16294330
TCAACAACAACAACTCAACAACAACintergenicDe novo--Yuen2017 G
POTEH     AU021204chr22:
16346327-16346327
TCintergenicDe novo--Yuen2017 G
POTEH     2-0022-003chr22:
16356244-16356244
GAintergenicDe novo--Yuen2017 G
POTEH     AU2139305chr22:
16363197-16363197
CTintergenicDe novo--Yuen2017 G
POTEH     1-0998-003chr22:
16446185-16446185
AGintergenicDe novo--Yuen2017 G
POTEH     AU4028302chr22:
16380759-16380759
AGintergenicDe novo--Yuen2017 G
POTEH     2-1195-003chr22:
16356119-16356119
AGintergenicDe novo--Yuen2017 G
POTEH     2-1521-003chr22:
16384939-16384939
CAintergenicDe novo--Yuen2017 G
POTEH     AU4028302chr22:
16384310-16384310
TCintergenicDe novo--Yuen2017 G
POTEH     2-1384-003chr22:
16352502-16352502
CTintergenicDe novo--Yuen2017 G
POTEH     7-0255-003chr22:
16283255-16283255
TCintronicDe novo--Yuen2017 G
POTEH     AU3721301chr22:
16320021-16320021
TCintergenicDe novo--Yuen2017 G
POTEH     AU3724302chr22:
16340034-16340034
GAintergenicDe novo--Yuen2017 G
POTEH     AU4079301chr22:
16305821-16305821
TAintergenicDe novo--Yuen2017 G
POTEH     2-1510-003chr22:
16363197-16363197
CTintergenicDe novo--Yuen2017 G
POTEH     AU3846303chr22:
16283315-16283315
CTintronicDe novo--Yuen2017 G
POTEH     AU024104chr22:
16435051-16435051
GAintergenicDe novo--Yuen2017 G
POTEH     AU073005chr22:
16380522-16380522
GAintergenicDe novo--Yuen2017 G
POTEH     AU4015301chr22:
16424146-16424146
GAintergenicDe novo--Yuen2017 G
POTEH     Bruno2021:XVIIchr22:
16287339-16287339
CTexonicDe novononsynonymous SNVNM_001136213c.G547Ap.A183T14.412.0E-4Bruno2021 E
POTEH     7-0149-003chr22:
16296459-16296459
GAintergenicDe novo--Yuen2017 G
POTEH     7-0149-003chr22:
16384274-16384274
CTintergenicDe novo--Yuen2017 G
POTEH     AU1698301chr22:
16356119-16356119
AGintergenicDe novo--Yuen2017 G
POTEH     13933.p1chr22:
16279213-16279213
GAexonicMosaicnonsynonymous SNVNM_001136213c.C1010Tp.A337V9.452-Lim2017 E
POTEH     AU3124302chr22:
16365578-16365578
AGintergenicDe novo--Yuen2017 G
POTEH     AU4015303chr22:
16263657-16263657
TAintronicDe novo--Yuen2017 G
POTEH     1-0777-003chr22:
16362864-16362864
GAintergenicDe novo--Yuen2017 G
POTEH     AU2975302chr22:
16394044-16394044
TCintergenicDe novo--Yuen2017 G
POTEH     AU056604chr22:
16298391-16298394
CATACAintergenicDe novo--Yuen2017 G
POTEH     09C96031chr22:
16287579-16287579
AAGexonicDe novoframeshift insertionNM_001136213c.306dupCp.C103fs--DeRubeis2014 E
Kosmicki2017 E
POTEH     AU2137304chr22:
16292396-16292396
GAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More