or
or
Exact

Results for "MACF1"

Variant Events: 47

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MACF1     PN400283chr1:
39903464-39903464
GAexonicUnknownnonsynonymous SNVNM_012090c.G11827Ap.E3943K35.05.0E-4Leblond2019 E
MACF1     2-1146-003chr1:
39779361-39779361
AGintronicDe novo--Yuen2017 G
MACF1     C218203chr1:
39799017-39799017
ACintronicDe novo0.043-Fu2022 E
MACF1     14196_p1chr1:
39838232-39838232
AGexonicDe novononsynonymous SNVNM_012090c.A6991Gp.M2331V8.865-Fu2022 E
MACF1     2-0122-004chr1:
39637747-39637747
GTintronicDe novo--Yuen2017 G
MACF1     AU3721301chr1:
39874223-39874223
GAintronicDe novo--Yuen2017 G
MACF1     1-0745-003chr1:
39715346-39715346
GAintronicDe novo--Yuen2017 G
MACF1     AU4394302chr1:
39780126-39780140
TACACACACACACACTACACACACACintronicDe novo--Yuen2017 G
MACF1     19-984080-19chr1:
39796883-39796883
AGintronicDe novo--Satterstrom2020 E
MACF1     PN400584chr1:
39903464-39903464
GAexonicUnknownnonsynonymous SNVNM_012090c.G11827Ap.E3943K35.05.0E-4Leblond2019 E
MACF1     1-0004-003chr1:
39677547-39677547
TCintronicDe novo--Yuen2017 G
MACF1     PN400241chr1:
39812757-39812757
CTintronicUnknown47.0-Leblond2019 E
MACF1     AU3859301chr1:
39591733-39591733
CTintronicDe novo--Yuen2017 G
MACF1     PN400576chr1:
39903464-39903464
GAexonicUnknown, Inheritednonsynonymous SNVNM_012090c.G11827Ap.E3943K35.05.0E-4Leblond2019 E
Leblond2019 E
MACF1     SP0042217chr1:
39789949-39789949
CTexonicMosaicstopgainNM_012090c.C4336Tp.Q1446X24.5-Feliciano2019 E
MACF1     11190.p1chr1:
39799059-39799059
AAGGintronicDe novo--Satterstrom2020 E
MACF1     AU3859301chr1:
39598224-39598224
GCintronicDe novo--Yuen2017 G
MACF1     1-0196-005chr1:
39720024-39720024
CTexonicDe novosynonymous SNVNM_012090c.C427Tp.L143L--Yuen2017 G
MACF1     1-0345-004chr1:
39837230-39837230
AGintronicDe novo--Yuen2017 G
MACF1     AU4159301chr1:
39858419-39858419
TAintronicDe novo--Yuen2017 G
MACF1     AU4012302chr1:
39905777-39905778
TCTintronicDe novo--Yuen2017 G
MACF1     2-1272-003chr1:
39904691-39904691
GTintronicDe novo--Yuen2016 G
MACF1     AU4315302chr1:
39787039-39787039
ACintronicDe novo--Yuen2017 G
MACF1     PN400518chr1:
39812757-39812757
CTintronicUnknown47.0-Leblond2019 E
MACF1     14196.p1chr1:
39838232-39838232
AGexonicDe novononsynonymous SNVNM_012090c.A6991Gp.M2331V8.865-Iossifov2014 E
Kosmicki2017 E
Krupp2017 E
Lim2017 E
Satterstrom2020 E
MACF1     13502.p1chr1:
39784265-39784265
CTexonicMosaicnonsynonymous SNVNM_012090c.C3938Tp.S1313L23.41.0E-4Krupp2017 E
MACF1     1-0010-003chr1:
39720552-39720552
TAintronicDe novo--Yuen2017 G
MACF1     1-0180-004chr1:
39742060-39742060
AAGintronicDe novo--Yuen2017 G
MACF1     111304chr1:
39900258-39900258
CTexonicnonsynonymous SNVNM_012090c.C11552Tp.P3851L33.01.648E-5Woodbury-Smith2022 E
MACF1     PN400249chr1:
39903464-39903464
GAexonicUnknownnonsynonymous SNVNM_012090c.G11827Ap.E3943K35.05.0E-4Leblond2019 E
MACF1     PN400100chr1:
39903464-39903464
GAexonicUnknownnonsynonymous SNVNM_012090c.G11827Ap.E3943K35.05.0E-4Leblond2019 E
MACF1     12521.p1chr1:
39903616-39903616
GAexonicMosaicsynonymous SNVNM_012090c.G11979Ap.L3993L5.037-Krupp2017 E
MACF1     2-0225-004chr1:
39634473-39634473
GAintronicDe novo--Yuen2017 G
MACF1     AU030703chr1:
39910108-39910108
AGintronicDe novo--Yuen2017 G
MACF1     1-0336-003chr1:
39713079-39713079
AGintronicDe novo--Yuen2017 G
MACF1     12011.p1chr1:
39601832-39601832
GAintronicDe novo--Turner2016 G
MACF1     PN400127chr1:
39812757-39812757
CTintronicUnknown47.0-Leblond2019 E
MACF1     F5980-1chr1:
39826589-39826589
TCexonicDe novosynonymous SNVNM_012090c.T6183Cp.I2061I3.27-Fu2022 E
Satterstrom2020 E
MACF1     SP0107946chr1:
39889627-39889627
GGTintronicDe novo--Fu2022 E
MACF1     SP0148140chr1:
39823030-39823030
GCintronicDe novo--Fu2022 E
MACF1     A202403chr1:
39696859-39696859
CTexonicDe novononsynonymous SNVNM_012090c.C226Tp.R76W28.8-Fu2022 E
MACF1     PN400441chr1:
39903464-39903464
GAexonicUnknownnonsynonymous SNVNM_012090c.G11827Ap.E3943K35.05.0E-4Leblond2019 E
MACF1     SP0033688chr1:
39900290-39900290
CAexonicDe novononsynonymous SNVNM_012090c.C11584Ap.Q3862K33.0-Fu2022 E
MACF1     JASD_Fam0138chr1:
39917969-39917970
GTGexonicDe novoframeshift deletionNM_012090c.14384delTp.V4795fs--Takata2018 E
MACF1     2-0299-005chr1:
39719293-39719293
CGintronicDe novo--Yuen2017 G
MACF1     AU054303chr1:
39947216-39947216
AGintronicDe novo--Yuen2017 G
MACF1     SP0098450chr1:
39845949-39845949
AGexonicDe novononsynonymous SNVNM_012090c.A7366Gp.K2456E20.81.656E-5Fu2022 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More