or
or
Exact

Results for "KIAA1549"

Variant Events: 45

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
KIAA1549     SP0185417chr7:
138665975-138665975
TAexonicDe novononsynonymous SNVNM_001164665
NM_020910
c.A41T
c.A41T
p.E14V
p.E14V
10.07-Trost2022 G
Zhou2022 GE
KIAA1549     SP0124659chr7:
138665913-138665913
GCexonicnonsynonymous SNVNM_001164665
NM_020910
c.C103G
c.C103G
p.R35G
p.R35G
8.735-Zhou2022 GE
KIAA1549     2-1212-003chr7:
138634687-138634687
GAintronicDe novo--Trost2022 G
Yuen2017 G
KIAA1549     SP0257917chr7:
138603434-138603434
TCexonicnonsynonymous SNVNM_001164665
NM_020910
c.A938G
c.A938G
p.E313G
p.E313G
12.69-Zhou2022 GE
KIAA1549     SP0007905 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
Trost2022 G
KIAA1549     SP0028252 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
KIAA1549     SP0019104chr7:
138556024-138556024
TGexonicDe novononsynonymous SNVNM_001164665
NM_020910
c.A4430C
c.A4430C
p.E1477A
p.E1477A
23.9-Fu2022 E
Trost2022 G
Zhou2022 GE
KIAA1549     1008chr7:
138533426-138533426
TGintronicDe novo--Trost2022 G
KIAA1549     13964.p1chr7:
138665891-138665894
GGGCGexonicDe novononframeshift deletionNM_001164665
NM_020910
c.122_124del
c.122_124del
p.41_42del
p.41_42del
--Satterstrom2020 E
Trost2022 G
KIAA1549     1-0150-004chr7:
138534759-138534759
TGintronicDe novo--Trost2022 G
KIAA1549     09C91113chr7:
138552798-138552798
GAexonicDe novononsynonymous SNVNM_001164665
NM_020910
c.C4852T
c.C4852T
p.R1618W
p.R1618W
17.22.545E-5Neale2012 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
KIAA1549     MT_170.3chr7:
138529652-138529652
TCintronicDe novo--Trost2022 G
KIAA1549     2-0299-005chr7:
138610093-138610093
TAintronicDe novo--Trost2022 G
Yuen2017 G
KIAA1549     SP0032272chr7:
138555898-138555898
ACintronicDe novo--Trost2022 G
KIAA1549     SP0114300chr7:
138555898-138555898
ACintronicDe novo--Trost2022 G
KIAA1549     SP0148872 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
Trost2022 G
KIAA1549     SP0155288 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
Trost2022 G
KIAA1549     G01-GEA-206-HIchr7:
138579137-138579137
TCexonicDe novononsynonymous SNVNM_001164665
NM_020910
c.A3983G
c.A3983G
p.K1328R
p.K1328R
25.5-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
KIAA1549     SP0120666 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
KIAA1549     SP0067215chr7:
138591662-138591662
CGintronicDe novo--Fu2022 E
Trost2022 G
Zhou2022 GE
KIAA1549     SP0137371 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
KIAA1549     SP0052491 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
Trost2022 G
KIAA1549     SP0091585 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
Trost2022 G
KIAA1549     2-1228-003chr7:
138563948-138563948
CTintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
KIAA1549     AU3586303chr7:
138604951-138604951
CTintronicDe novo--Trost2022 G
KIAA1549     mAGRE1095chr7:
138665980-138665999
GGCCGCGCCTCGGCGTCGGCGexonicMaternalframeshift deletionNM_001164665
NM_020910
c.17_35del
c.17_35del
p.R6fs
p.R6fs
--Cirnigliaro2023 G
KIAA1549     AU3862305chr7:
138604951-138604951
CTintronicDe novo--Trost2022 G
KIAA1549     1-0009-004chr7:
138604951-138604951
CTintronicDe novo--Trost2022 G
KIAA1549     7-0288-004chr7:
138604951-138604951
CTintronicDe novo--Trost2022 G
KIAA1549     1-1116-003chr7:
138600287-138600287
GAintronicDe novo--Trost2022 G
KIAA1549     1-1112-003chr7:
138604896-138604896
ACintronicDe novo--Trost2022 G
KIAA1549     SP0174587 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
KIAA1549     SP0058437chr7:
138555899-138555899
ACintronicDe novo--Trost2022 G
KIAA1549     AU1987304chr7:
138560855-138560855
ACintronicDe novo--Trost2022 G
Yuen2017 G
KIAA1549     MSSNG00153-003chr7:
138654790-138654790
TCintronicDe novo--Trost2022 G
KIAA1549     2-1507-003chr7:
138520143-138520143
TCUTR3De novo--Trost2022 G
Yuen2017 G
KIAA1549     AU3937301chr7:
138604951-138604951
CTintronicDe novo--Trost2022 G
KIAA1549     AU4129303chr7:
138604951-138604951
CTintronicDe novo--Trost2022 G
KIAA1549     5-0025-003chr7:
138542813-138542813
GAintronicDe novo--Trost2022 G
Yuen2017 G
KIAA1549     122063chr7:
138604138-138604138
CGexonicDe novononsynonymous SNVNM_001164665
NM_020910
c.G234C
c.G234C
p.E78D
p.E78D
10.13-Fu2022 E
KIAA1549     11008_p1chr7:
138591796-138591796
ACexonicDe novononsynonymous SNVNM_001164665
NM_020910
c.T3329G
c.T3329G
p.V1110G
p.V1110G
18.6-Fu2022 E
KIAA1549     AU3263301chr7:
138704922-138704922
GAintergenicDe novo--Yuen2017 G
KIAA1549     1-0051-004chr7:
138691330-138691330
GAintergenicDe novo--Yuen2017 G
KIAA1549     1-0107-003chr7:
138536734-138536734
GTintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
KIAA1549     AU2109302chr7:
138548655-138548655
TCintronicDe novo--Trost2022 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More